Mutagenetix > Incidental Mutations

Incidental Mutation 'R7376:Specc1'

572407

Institutional Source

Beutler Lab

Gene Symbol

Specc1

Ensembl Gene

ENSMUSG00000042331

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms

Cytsb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R7376 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61956763-62223013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62118252 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 198 (I198K)

Ref Sequence

ENSEMBL: ENSMUSP00000144300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000092415] [ENSMUST00000108709] [ENSMUST00000201015] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000201723] [ENSMUST00000202178] [ENSMUST00000202179] [ENSMUST00000202389] [ENSMUST00000202744] [ENSMUST00000202905]

Predicted Effect

probably benign
Transcript: ENSMUST00000049836
AA Change: I278K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092415
AA Change: I198K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000090071
Gene: ENSMUSG00000042331
AA Change: I198K

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	832	844	N/A	INTRINSIC
CH	883	981	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108709
AA Change: I278K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201015

SMART Domains

Protein: ENSMUSP00000144174
Gene: ENSMUSG00000042331

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC
low complexity region	225	236	N/A	INTRINSIC
low complexity region	252	264	N/A	INTRINSIC
CH	303	401	1.4e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201364
AA Change: I278K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
CH	954	1052	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201624
AA Change: I278K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201671
AA Change: I278K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201723
AA Change: I198K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000144542
Gene: ENSMUSG00000042331
AA Change: I198K

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202178
AA Change: I278K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202179
AA Change: I198K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000144300
Gene: ENSMUSG00000042331
AA Change: I198K

Domain	Start	End	E-Value	Type
low complexity region	43	63	N/A	INTRINSIC
coiled coil region	79	116	N/A	INTRINSIC
coiled coil region	144	179	N/A	INTRINSIC
low complexity region	231	236	N/A	INTRINSIC
coiled coil region	282	374	N/A	INTRINSIC
coiled coil region	399	440	N/A	INTRINSIC
coiled coil region	495	693	N/A	INTRINSIC
low complexity region	796	807	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
CH	874	972	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202389
AA Change: I278K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202744

SMART Domains

Protein: ENSMUSP00000144483
Gene: ENSMUSG00000042331

Domain	Start	End	E-Value	Type
coiled coil region	23	113	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202905
AA Change: I278K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: I278K

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,291,118	I994V	probably benign	Het
Acan	T	G	7: 79,088,307		probably null	Het
Adamts12	G	A	15: 11,277,339	V680I	possibly damaging	Het
Adgrg7	T	C	16: 56,724,979	I712V	probably damaging	Het
Adgrl3	A	G	5: 81,794,750	H1477R	probably damaging	Het
Adgrv1	T	A	13: 81,518,126	D1937V	probably damaging	Het
Alms1	T	C	6: 85,622,106	S1305P	probably benign	Het
Banp	T	A	8: 121,974,497	M39K	probably damaging	Het
Bbs10	A	G	10: 111,299,250	T75A	probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Brinp2	C	T	1: 158,251,368	C295Y	probably damaging	Het
Card11	C	T	5: 140,898,238	V429I	probably benign	Het
Cdca3	G	A	6: 124,832,575	R184H	probably benign	Het
Cep104	A	G	4: 153,983,052		probably null	Het
Clspn	A	G	4: 126,590,637	K1196R	possibly damaging	Het
Cntnap5b	A	G	1: 99,967,269	T89A	possibly damaging	Het
Cpne9	A	T	6: 113,290,013	I136L	probably damaging	Het
Crat	T	A	2: 30,406,465	I330F	probably damaging	Het
Ctbp2	G	T	7: 133,013,968	Q413K	possibly damaging	Het
D630045J12Rik	T	C	6: 38,174,303	E1220G	probably damaging	Het
Dap	A	G	15: 31,235,839	D41G	probably damaging	Het
Dnah14	A	G	1: 181,763,402	I3287V	probably benign	Het
Dsp	A	G	13: 38,172,843	H233R	probably damaging	Het
Dst	T	C	1: 34,192,689	I3121T	probably benign	Het
Espnl	T	G	1: 91,322,314	L61R	probably damaging	Het
Evc2	T	C	5: 37,370,639	S331P	possibly damaging	Het
Gars	A	G	6: 55,073,359	E535G	probably benign	Het
Hfm1	A	G	5: 106,895,218	I650T	possibly damaging	Het
Iyd	T	A	10: 3,545,690	I116N	probably damaging	Het
Kif16b	A	G	2: 142,711,872	L1002S	probably damaging	Het
Kif1bp	C	T	10: 62,559,064	V600I	possibly damaging	Het
Lgi1	G	A	19: 38,284,020	G113D	probably damaging	Het
Lgi2	G	A	5: 52,538,262	R452C	probably damaging	Het
Man2b2	T	G	5: 36,813,378	N764T	probably damaging	Het
Mrps18b	A	G	17: 35,910,695	I246T	probably benign	Het
Muc5b	A	G	7: 141,872,550	T4795A	possibly damaging	Het
Mybl2	G	A	2: 163,082,593	G627D	possibly damaging	Het
Ndufb8	C	T	19: 44,555,355	R16K	probably benign	Het
Olfr181	A	T	16: 58,925,758	V271E	possibly damaging	Het
P4htm	C	T	9: 108,580,792	V335M	probably damaging	Het
Pbx3	A	G	2: 34,204,877	I249T	probably damaging	Het
Plod3	G	T	5: 136,990,481	V360L	probably benign	Het
Podxl2	C	T	6: 88,849,650	D161N	probably benign	Het
Polr1b	G	T	2: 129,119,073	V651L	probably benign	Het
Prr14	T	C	7: 127,476,577	S586P	probably benign	Het
Pum3	C	T	19: 27,394,328	G575D	probably benign	Het
Rnf157	C	A	11: 116,360,366	A111S	probably benign	Het
Robo3	A	G	9: 37,432,916	L29P	probably damaging	Het
Smarca5	T	C	8: 80,726,051	N342S	probably damaging	Het
Tmem177	A	T	1: 119,910,014	*312R	probably null	Het
Tom1l2	A	T	11: 60,261,200	M172K	probably benign	Het
Tsc22d4	T	C	5: 137,758,152	V3A	unknown	Het
Uhrf1bp1l	G	A	10: 89,809,656	G1197D	probably damaging	Het
Vmn1r128	G	T	7: 21,349,743	G124V	probably damaging	Het
Vmn1r15	T	C	6: 57,258,357	I70T	probably benign	Het
Vmn2r60	A	G	7: 42,195,207	T665A	probably damaging	Het
Vmn2r83	T	C	10: 79,478,956	F346S	probably benign	Het
Wdr7	T	A	18: 63,777,620	D694E	probably damaging	Het

Other mutations in Specc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Specc1	APN	11	62118009	missense	probably benign	0.02
IGL01953:Specc1	APN	11	62118296	missense	probably benign	0.40
IGL02244:Specc1	APN	11	62128368	missense	probably benign	0.41
IGL02257:Specc1	APN	11	62118417	missense	probably damaging	1.00
IGL02512:Specc1	APN	11	62118389	missense	probably damaging	1.00
IGL03147:Specc1	UTSW	11	62118282	missense	probably benign
R0039:Specc1	UTSW	11	62029369	missense	probably damaging	0.97
R0114:Specc1	UTSW	11	62146313	missense	possibly damaging	0.92
R0635:Specc1	UTSW	11	62118903	missense	probably damaging	1.00
R1514:Specc1	UTSW	11	62156532	missense	probably damaging	1.00
R1604:Specc1	UTSW	11	62043057	missense	probably damaging	1.00
R1717:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1719:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1739:Specc1	UTSW	11	62118818	nonsense	probably null
R1757:Specc1	UTSW	11	62119284	critical splice donor site	probably null
R1990:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R1991:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R2063:Specc1	UTSW	11	62118296	missense	probably benign	0.01
R2071:Specc1	UTSW	11	62117875	missense	probably damaging	0.98
R2245:Specc1	UTSW	11	62131887	missense	probably damaging	1.00
R3415:Specc1	UTSW	11	62118419	missense	probably benign	0.29
R3831:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R3890:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R3891:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R4367:Specc1	UTSW	11	62118530	missense	probably damaging	1.00
R4489:Specc1	UTSW	11	62151827	splice site	probably null
R4580:Specc1	UTSW	11	62219331	missense	probably damaging	1.00
R4852:Specc1	UTSW	11	62211684	missense	probably damaging	1.00
R4930:Specc1	UTSW	11	62118958	missense	possibly damaging	0.93
R5016:Specc1	UTSW	11	62118957	missense	possibly damaging	0.92
R5416:Specc1	UTSW	11	62118909	missense	probably benign	0.00
R5650:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R6158:Specc1	UTSW	11	62118124	missense	probably damaging	0.99
R6329:Specc1	UTSW	11	62156553	missense	probably damaging	1.00
R6374:Specc1	UTSW	11	62156592	missense	possibly damaging	0.93
R6395:Specc1	UTSW	11	62132338	missense	probably damaging	1.00
R6653:Specc1	UTSW	11	62146418	missense	probably damaging	0.99
R6893:Specc1	UTSW	11	62132453	missense	probably benign
R6898:Specc1	UTSW	11	62118336	missense	probably benign
R7054:Specc1	UTSW	11	62117778	missense	probably damaging	0.96
R7294:Specc1	UTSW	11	62118337	missense	probably benign	0.01
R7560:Specc1	UTSW	11	62128409	critical splice donor site	probably null
R7605:Specc1	UTSW	11	62211680	missense	possibly damaging	0.91
R7621:Specc1	UTSW	11	62128384	missense	possibly damaging	0.96
R7804:Specc1	UTSW	11	62205397	missense	probably damaging	0.99
R7900:Specc1	UTSW	11	62219361	missense	probably damaging	1.00
R8310:Specc1	UTSW	11	62132345	missense	probably damaging	1.00
R8319:Specc1	UTSW	11	62118675	missense	possibly damaging	0.77
Z1177:Specc1	UTSW	11	62118767	missense	possibly damaging	0.86
Z1177:Specc1	UTSW	11	62205423	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- TCCCCAGAAAGTGATGCAC -3'
(R):5'- AAAGGGTTGCTAGTGGCTGAC -3'

Sequencing Primer
(F):5'- GTGATGCACAGCCTTTGATAAGAACC -3'
(R):5'- TAGTGGCTGACAGGGGC -3'

Posted On

2019-09-13