Incidental Mutation 'R7376:Olfr181'
ID572414
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7376 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58925758 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 271 (V271E)
Ref Sequence ENSEMBL: ENSMUSP00000074825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075361
AA Change: V271E

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: V271E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect possibly damaging
Transcript: ENSMUST00000205742
AA Change: V271E

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205986
AA Change: V271E

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Meta Mutation Damage Score 0.3449 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Cep104 A G 4: 153,983,052 probably null Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
R8153:Olfr181 UTSW 16 58925786 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CCAAACAGTTGATGCCTGGC -3'
(R):5'- GCCAATTCAAGTCTTTACCATTACC -3'

Sequencing Primer
(F):5'- GGTTTTGTACATTCTGGAAAACCAAC -3'
(R):5'- AAGTCTTTACCATTACCACTGTCTTG -3'
Posted On2019-09-13