Incidental Mutation 'R7376:Lgi1'
ID572419
Institutional Source Beutler Lab
Gene Symbol Lgi1
Ensembl Gene ENSMUSG00000067242
Gene Nameleucine-rich repeat LGI family, member 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R7376 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38264536-38312214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38284020 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 113 (G113D)
Ref Sequence ENSEMBL: ENSMUSP00000143128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087252] [ENSMUST00000196090] [ENSMUST00000197123] [ENSMUST00000198045] [ENSMUST00000198518] [ENSMUST00000199812]
Predicted Effect probably benign
Transcript: ENSMUST00000087252
SMART Domains Protein: ENSMUSP00000084507
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 225 266 3.8e-9 PFAM
Pfam:EPTP 271 312 6.5e-12 PFAM
Pfam:EPTP 317 363 7.2e-16 PFAM
Pfam:EPTP 366 414 1.4e-7 PFAM
Pfam:EPTP 419 461 1.6e-12 PFAM
Pfam:EPTP 464 505 7.7e-11 PFAM
Pfam:EPTP 510 550 3.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196090
SMART Domains Protein: ENSMUSP00000143538
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 3.3e-4 SMART
LRRCT 125 174 2.3e-8 SMART
Pfam:EPTP 177 218 3.1e-6 PFAM
Pfam:EPTP 223 264 5.3e-9 PFAM
Pfam:EPTP 269 315 5.8e-13 PFAM
Pfam:EPTP 318 366 1.1e-4 PFAM
Pfam:EPTP 371 413 1.3e-9 PFAM
Pfam:EPTP 416 457 6.2e-8 PFAM
Pfam:EPTP 462 502 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197123
SMART Domains Protein: ENSMUSP00000142953
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198045
AA Change: G113D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143292
Gene: ENSMUSG00000067242
AA Change: G113D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
LRR 90 113 1.1e0 SMART
LRR_TYP 114 137 2.1e-5 SMART
LRR_TYP 138 161 9.2e-7 SMART
LRRCT 173 222 2.3e-8 SMART
Pfam:EPTP 224 267 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198518
AA Change: G113D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143128
Gene: ENSMUSG00000067242
AA Change: G113D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 224 267 8.3e-15 PFAM
Pfam:EPTP 270 313 9.4e-16 PFAM
Pfam:EPTP 316 364 3.3e-18 PFAM
Pfam:EPTP 365 415 5.2e-8 PFAM
Pfam:EPTP 418 462 1e-16 PFAM
Pfam:EPTP 463 506 1.9e-15 PFAM
Pfam:EPTP 509 550 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199812
AA Change: G89D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143502
Gene: ENSMUSG00000067242
AA Change: G89D

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 2.2e-5 SMART
LRR_TYP 114 137 9.4e-7 SMART
LRRCT 149 198 2.3e-8 SMART
Pfam:EPTP 201 242 3.2e-6 PFAM
Pfam:EPTP 247 288 5.6e-9 PFAM
Pfam:EPTP 293 339 6.1e-13 PFAM
Pfam:EPTP 342 390 1.2e-4 PFAM
Pfam:EPTP 395 437 1.4e-9 PFAM
Pfam:EPTP 440 481 6.6e-8 PFAM
Pfam:EPTP 486 526 2.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the secreted leucine-rich repeat (LRR) superfamily and shares homology with members of the SLIT protein family. The encoded protein may regulate the activity of voltage-gated potassium channels and may be involved in neuronal growth regulation and cell survival. This gene is rearranged as a result of translocations in glioblastoma cell lines, and it is frequently down-regulated or rearranged in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, seizures, and death by the third week of life. Mice heterozygous for this allele exhibit increased suseptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Cep104 A G 4: 153,983,052 probably null Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Other mutations in Lgi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Lgi1 APN 19 38284005 missense probably benign 0.24
IGL03112:Lgi1 APN 19 38284030 missense possibly damaging 0.84
R0201:Lgi1 UTSW 19 38301293 missense possibly damaging 0.92
R1573:Lgi1 UTSW 19 38284181 missense probably benign 0.30
R1795:Lgi1 UTSW 19 38306183 missense probably benign
R2010:Lgi1 UTSW 19 38301235 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3733:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R4643:Lgi1 UTSW 19 38300710 missense probably damaging 1.00
R4678:Lgi1 UTSW 19 38301289 missense probably damaging 1.00
R4814:Lgi1 UTSW 19 38300878 critical splice donor site probably null
R4857:Lgi1 UTSW 19 38306250 missense probably damaging 1.00
R5598:Lgi1 UTSW 19 38306181 missense possibly damaging 0.94
R6180:Lgi1 UTSW 19 38264956 missense probably damaging 1.00
R6196:Lgi1 UTSW 19 38305809 missense probably benign 0.23
R6847:Lgi1 UTSW 19 38301290 missense probably damaging 1.00
R7178:Lgi1 UTSW 19 38306285 missense probably damaging 1.00
R7448:Lgi1 UTSW 19 38301265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTCAGGAGGAGACATTC -3'
(R):5'- AAGACTTGAGTCCCCGGAAAG -3'

Sequencing Primer
(F):5'- CTGCCAAGGTTTTCTGTAGAGAAACG -3'
(R):5'- ACTTGAGTCCCCGGAAAGTATGTC -3'
Posted On2019-09-13