Incidental Mutation 'R7378:Asxl1'
ID572439
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Nameadditional sex combs like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7378 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location153345829-153404007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153401993 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1489 (C1489R)
Ref Sequence ENSEMBL: ENSMUSP00000105413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
Predicted Effect probably damaging
Transcript: ENSMUST00000109790
AA Change: C1489R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: C1489R

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227428
AA Change: C1488R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9128 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (138/140)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,546,247 probably null Het
Aars A G 8: 111,042,342 Y258C probably damaging Het
Acaa2 A T 18: 74,805,872 Y376F probably benign Het
Adcy1 C T 11: 7,169,543 S1062F possibly damaging Het
Adgrb3 A T 1: 25,531,919 C492* probably null Het
Adgrg6 A G 10: 14,535,892 F22S probably benign Het
Adh1 A G 3: 138,288,887 probably null Het
Afm T A 5: 90,551,400 C568S probably benign Het
Ago4 C T 4: 126,511,464 E439K probably benign Het
Aifm2 T G 10: 61,727,717 V122G possibly damaging Het
Akap6 A G 12: 53,142,574 N2257S probably benign Het
Ap3m2 A G 8: 22,804,010 I8T probably benign Het
Apc2 C A 10: 80,311,394 L761I probably damaging Het
Arntl C A 7: 113,299,208 T281K probably benign Het
Asap2 A G 12: 21,112,051 D3G probably benign Het
Asna1 A T 8: 85,019,863 F119I probably benign Het
Atm T G 9: 53,453,437 probably null Het
Bpifa6 C A 2: 153,986,433 A153E probably damaging Het
Cav2 A G 6: 17,282,060 T106A probably benign Het
Cavin4 A G 4: 48,663,631 N4D probably benign Het
Cenpc1 T C 5: 86,046,499 N136S probably benign Het
Cfap45 T A 1: 172,538,343 probably null Het
Col3a1 G A 1: 45,327,647 probably null Het
Crocc2 C T 1: 93,194,087 L653F probably damaging Het
Cry2 A G 2: 92,413,664 L388P probably damaging Het
Cstb T C 10: 78,426,988 F43S probably damaging Het
Ctcfl A G 2: 173,112,258 Y349H probably damaging Het
Ctu2 T A 8: 122,481,499 V485D probably damaging Het
Cwc25 A C 11: 97,747,997 L367R possibly damaging Het
Dock4 T A 12: 40,788,244 H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,752,642 V26L probably benign Het
Dusp27 G T 1: 166,112,063 S58* probably null Het
Elmo1 A T 13: 20,280,935 I225F probably benign Het
Ep300 T C 15: 81,650,545 S2268P probably damaging Het
F2r C T 13: 95,618,328 C16Y probably damaging Het
Fam126b T C 1: 58,530,034 K462R probably benign Het
Fbxo33 C A 12: 59,204,371 E453* probably null Het
Flot1 A T 17: 35,825,513 D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fras1 T C 5: 96,596,785 C560R probably damaging Het
Gfi1 A T 5: 107,723,229 S165T possibly damaging Het
Gli2 T C 1: 118,848,492 D400G probably damaging Het
Gm11639 T C 11: 104,714,702 I298T probably benign Het
Gm37240 T A 3: 84,972,637 probably null Het
Gml C T 15: 74,817,121 V27I possibly damaging Het
Htt A T 5: 34,803,799 I257F probably benign Het
Ier5 C T 1: 155,098,692 V247M probably damaging Het
Ift46 C T 9: 44,778,595 probably benign Het
Il12b A G 11: 44,407,894 T59A probably benign Het
Insr A G 8: 3,198,231 L438P probably damaging Het
Iqgap2 C T 13: 95,732,890 probably null Het
Irx4 A T 13: 73,267,553 T154S possibly damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Kcns2 T A 15: 34,839,703 L404* probably null Het
Kif2c T C 4: 117,162,029 E644G possibly damaging Het
Klhl22 T C 16: 17,776,805 L266P probably damaging Het
Krt71 T A 15: 101,738,329 K315* probably null Het
Lca5 T C 9: 83,395,530 N587S probably benign Het
Lrp1b T A 2: 41,295,669 M1459L Het
Lrrtm2 T C 18: 35,213,592 K219R probably damaging Het
Mcmbp T C 7: 128,704,517 D459G probably damaging Het
Megf8 A G 7: 25,348,942 H1680R probably damaging Het
Mia3 A G 1: 183,334,775 S301P probably benign Het
Mtrr A G 13: 68,564,402 Y622H probably damaging Het
Myo7b T A 18: 31,966,239 Q1710L probably damaging Het
Nab1 T C 1: 52,480,995 N276D probably damaging Het
Nalcn C T 14: 123,302,890 R1127H probably damaging Het
Nbas T A 12: 13,274,219 I110N probably damaging Het
Nfe2l3 C T 6: 51,457,296 Q279* probably null Het
Nlrp9c C T 7: 26,365,015 E963K probably benign Het
Nsmaf A G 4: 6,416,586 V569A probably benign Het
Olfr1066 T C 2: 86,456,068 T68A probably benign Het
Olfr1338 T C 4: 118,754,175 Y123C possibly damaging Het
Olfr199 T A 16: 59,215,920 D231V probably benign Het
Olfr273 C T 4: 52,856,421 V31I probably benign Het
Olfr481 T C 7: 108,081,192 S133P not run Het
Olfr669 A T 7: 104,939,431 I302F probably benign Het
Olfr69 T A 7: 103,767,930 I156F probably benign Het
Olfr851 T A 9: 19,497,102 M118K probably damaging Het
Olfr857 A T 9: 19,712,887 D20V probably damaging Het
Olfr933 T A 9: 38,975,721 V15E probably benign Het
Paf1 A G 7: 28,396,928 Y322C probably damaging Het
Pcdha2 C A 18: 36,939,385 A23D possibly damaging Het
Pcdhb6 G A 18: 37,335,172 C382Y probably damaging Het
Pdzd7 C T 19: 45,045,606 G13D probably damaging Het
Pik3r2 T C 8: 70,769,381 N586S probably benign Het
Pik3r3 T A 4: 116,270,830 D119E probably benign Het
Pkd2l1 T A 19: 44,153,715 I535F probably benign Het
Ppfia3 T C 7: 45,361,446 probably null Het
Ppl T A 16: 5,112,996 Q53L possibly damaging Het
Rimbp3 T G 16: 17,211,204 S831A probably benign Het
Rnps1 A G 17: 24,418,530 T49A unknown Het
Rpl7a T A 2: 26,912,007 probably null Het
Rrm2b T A 15: 37,931,647 E248D probably benign Het
Sdhaf4 A G 1: 23,996,358 F70L probably damaging Het
Sel1l3 A T 5: 53,116,409 S1038R probably benign Het
Selenoo T A 15: 89,089,478 F124I probably benign Het
Setbp1 A T 18: 78,857,486 Y989N probably damaging Het
Slc1a7 A G 4: 108,002,203 E163G possibly damaging Het
Slc22a2 T C 17: 12,612,391 F356S probably damaging Het
Slc24a4 C T 12: 102,239,176 P378L probably benign Het
Slc4a1ap A G 5: 31,527,527 D169G probably benign Het
Slc4a7 T A 14: 14,757,421 V422D probably damaging Het
Slitrk6 T C 14: 110,749,863 Y804C probably damaging Het
Smarcad1 T A 6: 65,110,376 H906Q probably benign Het
Smn1 A G 13: 100,127,865 T109A probably damaging Het
Sntb2 A G 8: 106,981,312 N236S probably damaging Het
Spag9 T A 11: 94,114,351 probably null Het
Spg11 C A 2: 122,058,429 G2154W probably damaging Het
Srsf6 T C 2: 162,934,569 S278P unknown Het
Stag3 G A 5: 138,281,960 R29H probably benign Het
Stambp C T 6: 83,563,906 V98I not run Het
Suco T C 1: 161,862,211 D89G possibly damaging Het
Suox C T 10: 128,671,041 V373I probably benign Het
Sv2b T A 7: 75,147,728 probably null Het
Tatdn2 T C 6: 113,704,701 L565P probably damaging Het
Tbpl2 T A 2: 24,094,700 E145V probably benign Het
Tlr1 T C 5: 64,925,228 I669V not run Het
Tmc1 A T 19: 20,868,389 F157I probably damaging Het
Tmem26 T G 10: 68,724,092 probably null Het
Tmem33 A T 5: 67,286,133 I218F probably benign Het
Tmem94 T A 11: 115,794,174 D862E probably damaging Het
Tnr T C 1: 159,884,862 probably null Het
Tnrc6c T C 11: 117,741,780 S1103P probably benign Het
Tomm70a T A 16: 57,146,044 Y453* probably null Het
Trabd C A 15: 89,085,290 R229S possibly damaging Het
Trappc10 T C 10: 78,193,418 D1095G probably damaging Het
Trim27 A G 13: 21,192,461 T460A possibly damaging Het
Tsen54 T G 11: 115,821,705 D433E probably benign Het
Ubap2 A G 4: 41,235,515 probably null Het
Vat1l A T 8: 114,289,392 N341Y possibly damaging Het
Vmn2r82 C G 10: 79,396,442 Y758* probably null Het
Vps16 T G 2: 130,438,179 V108G probably damaging Het
Vps53 T A 11: 76,077,074 I585F possibly damaging Het
Wrnip1 G A 13: 32,816,281 V424M probably benign Het
Yif1a G A 19: 5,089,790 V88M possibly damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfhx3 A G 8: 108,793,248 E334G probably damaging Het
Zfp277 T C 12: 40,315,853 D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 N1558K probably benign Het
Zfp3 A G 11: 70,772,073 K286R probably benign Het
Zfp366 T C 13: 99,229,515 C395R probably damaging Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0659:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153401900 missense probably benign 0.13
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3620:Asxl1 UTSW 2 153357155 missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7023:Asxl1 UTSW 2 153400549 missense probably benign 0.00
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7464:Asxl1 UTSW 2 153397785 missense probably benign 0.01
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153399401 missense probably damaging 1.00
R8383:Asxl1 UTSW 2 153393719 missense probably damaging 1.00
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTGCTACCTTTCCCAAAG -3'
(R):5'- AGCACTATAAATCTCATGGGGAG -3'

Sequencing Primer
(F):5'- TTCCCAAAGGCCTTGCTGG -3'
(R):5'- CTCATGGGGAGGCAAAATTTATC -3'
Posted On2019-09-13