Incidental Mutation 'R7378:A2ml1'
ID572468
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7378 (G1)
Quality Score222.009
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 128546247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably null
Transcript: ENSMUST00000060574
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (138/140)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,342 Y258C probably damaging Het
Acaa2 A T 18: 74,805,872 Y376F probably benign Het
Adcy1 C T 11: 7,169,543 S1062F possibly damaging Het
Adgrb3 A T 1: 25,531,919 C492* probably null Het
Adgrg6 A G 10: 14,535,892 F22S probably benign Het
Adh1 A G 3: 138,288,887 probably null Het
Afm T A 5: 90,551,400 C568S probably benign Het
Ago4 C T 4: 126,511,464 E439K probably benign Het
Aifm2 T G 10: 61,727,717 V122G possibly damaging Het
Akap6 A G 12: 53,142,574 N2257S probably benign Het
Ap3m2 A G 8: 22,804,010 I8T probably benign Het
Apc2 C A 10: 80,311,394 L761I probably damaging Het
Arntl C A 7: 113,299,208 T281K probably benign Het
Asap2 A G 12: 21,112,051 D3G probably benign Het
Asna1 A T 8: 85,019,863 F119I probably benign Het
Asxl1 T C 2: 153,401,993 C1489R probably damaging Het
Atm T G 9: 53,453,437 probably null Het
Bpifa6 C A 2: 153,986,433 A153E probably damaging Het
Cav2 A G 6: 17,282,060 T106A probably benign Het
Cavin4 A G 4: 48,663,631 N4D probably benign Het
Cenpc1 T C 5: 86,046,499 N136S probably benign Het
Cfap45 T A 1: 172,538,343 probably null Het
Col3a1 G A 1: 45,327,647 probably null Het
Crocc2 C T 1: 93,194,087 L653F probably damaging Het
Cry2 A G 2: 92,413,664 L388P probably damaging Het
Cstb T C 10: 78,426,988 F43S probably damaging Het
Ctcfl A G 2: 173,112,258 Y349H probably damaging Het
Ctu2 T A 8: 122,481,499 V485D probably damaging Het
Cwc25 A C 11: 97,747,997 L367R possibly damaging Het
Dock4 T A 12: 40,788,244 H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,752,642 V26L probably benign Het
Dusp27 G T 1: 166,112,063 S58* probably null Het
Elmo1 A T 13: 20,280,935 I225F probably benign Het
Ep300 T C 15: 81,650,545 S2268P probably damaging Het
F2r C T 13: 95,618,328 C16Y probably damaging Het
Fam126b T C 1: 58,530,034 K462R probably benign Het
Fbxo33 C A 12: 59,204,371 E453* probably null Het
Flot1 A T 17: 35,825,513 D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fras1 T C 5: 96,596,785 C560R probably damaging Het
Gfi1 A T 5: 107,723,229 S165T possibly damaging Het
Gli2 T C 1: 118,848,492 D400G probably damaging Het
Gm11639 T C 11: 104,714,702 I298T probably benign Het
Gm37240 T A 3: 84,972,637 probably null Het
Gml C T 15: 74,817,121 V27I possibly damaging Het
Htt A T 5: 34,803,799 I257F probably benign Het
Ier5 C T 1: 155,098,692 V247M probably damaging Het
Ift46 C T 9: 44,778,595 probably benign Het
Il12b A G 11: 44,407,894 T59A probably benign Het
Insr A G 8: 3,198,231 L438P probably damaging Het
Iqgap2 C T 13: 95,732,890 probably null Het
Irx4 A T 13: 73,267,553 T154S possibly damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Kcns2 T A 15: 34,839,703 L404* probably null Het
Kif2c T C 4: 117,162,029 E644G possibly damaging Het
Klhl22 T C 16: 17,776,805 L266P probably damaging Het
Krt71 T A 15: 101,738,329 K315* probably null Het
Lca5 T C 9: 83,395,530 N587S probably benign Het
Lrp1b T A 2: 41,295,669 M1459L Het
Lrrtm2 T C 18: 35,213,592 K219R probably damaging Het
Mcmbp T C 7: 128,704,517 D459G probably damaging Het
Megf8 A G 7: 25,348,942 H1680R probably damaging Het
Mia3 A G 1: 183,334,775 S301P probably benign Het
Mtrr A G 13: 68,564,402 Y622H probably damaging Het
Myo7b T A 18: 31,966,239 Q1710L probably damaging Het
Nab1 T C 1: 52,480,995 N276D probably damaging Het
Nalcn C T 14: 123,302,890 R1127H probably damaging Het
Nbas T A 12: 13,274,219 I110N probably damaging Het
Nfe2l3 C T 6: 51,457,296 Q279* probably null Het
Nlrp9c C T 7: 26,365,015 E963K probably benign Het
Nsmaf A G 4: 6,416,586 V569A probably benign Het
Olfr1066 T C 2: 86,456,068 T68A probably benign Het
Olfr1338 T C 4: 118,754,175 Y123C possibly damaging Het
Olfr199 T A 16: 59,215,920 D231V probably benign Het
Olfr273 C T 4: 52,856,421 V31I probably benign Het
Olfr481 T C 7: 108,081,192 S133P not run Het
Olfr669 A T 7: 104,939,431 I302F probably benign Het
Olfr69 T A 7: 103,767,930 I156F probably benign Het
Olfr851 T A 9: 19,497,102 M118K probably damaging Het
Olfr857 A T 9: 19,712,887 D20V probably damaging Het
Olfr933 T A 9: 38,975,721 V15E probably benign Het
Paf1 A G 7: 28,396,928 Y322C probably damaging Het
Pcdha2 C A 18: 36,939,385 A23D possibly damaging Het
Pcdhb6 G A 18: 37,335,172 C382Y probably damaging Het
Pdzd7 C T 19: 45,045,606 G13D probably damaging Het
Pik3r2 T C 8: 70,769,381 N586S probably benign Het
Pik3r3 T A 4: 116,270,830 D119E probably benign Het
Pkd2l1 T A 19: 44,153,715 I535F probably benign Het
Ppfia3 T C 7: 45,361,446 probably null Het
Ppl T A 16: 5,112,996 Q53L possibly damaging Het
Rimbp3 T G 16: 17,211,204 S831A probably benign Het
Rnps1 A G 17: 24,418,530 T49A unknown Het
Rpl7a T A 2: 26,912,007 probably null Het
Rrm2b T A 15: 37,931,647 E248D probably benign Het
Sdhaf4 A G 1: 23,996,358 F70L probably damaging Het
Sel1l3 A T 5: 53,116,409 S1038R probably benign Het
Selenoo T A 15: 89,089,478 F124I probably benign Het
Setbp1 A T 18: 78,857,486 Y989N probably damaging Het
Slc1a7 A G 4: 108,002,203 E163G possibly damaging Het
Slc22a2 T C 17: 12,612,391 F356S probably damaging Het
Slc24a4 C T 12: 102,239,176 P378L probably benign Het
Slc4a1ap A G 5: 31,527,527 D169G probably benign Het
Slc4a7 T A 14: 14,757,421 V422D probably damaging Het
Slitrk6 T C 14: 110,749,863 Y804C probably damaging Het
Smarcad1 T A 6: 65,110,376 H906Q probably benign Het
Smn1 A G 13: 100,127,865 T109A probably damaging Het
Sntb2 A G 8: 106,981,312 N236S probably damaging Het
Spag9 T A 11: 94,114,351 probably null Het
Spg11 C A 2: 122,058,429 G2154W probably damaging Het
Srsf6 T C 2: 162,934,569 S278P unknown Het
Stag3 G A 5: 138,281,960 R29H probably benign Het
Stambp C T 6: 83,563,906 V98I not run Het
Suco T C 1: 161,862,211 D89G possibly damaging Het
Suox C T 10: 128,671,041 V373I probably benign Het
Sv2b T A 7: 75,147,728 probably null Het
Tatdn2 T C 6: 113,704,701 L565P probably damaging Het
Tbpl2 T A 2: 24,094,700 E145V probably benign Het
Tlr1 T C 5: 64,925,228 I669V not run Het
Tmc1 A T 19: 20,868,389 F157I probably damaging Het
Tmem26 T G 10: 68,724,092 probably null Het
Tmem33 A T 5: 67,286,133 I218F probably benign Het
Tmem94 T A 11: 115,794,174 D862E probably damaging Het
Tnr T C 1: 159,884,862 probably null Het
Tnrc6c T C 11: 117,741,780 S1103P probably benign Het
Tomm70a T A 16: 57,146,044 Y453* probably null Het
Trabd C A 15: 89,085,290 R229S possibly damaging Het
Trappc10 T C 10: 78,193,418 D1095G probably damaging Het
Trim27 A G 13: 21,192,461 T460A possibly damaging Het
Tsen54 T G 11: 115,821,705 D433E probably benign Het
Ubap2 A G 4: 41,235,515 probably null Het
Vat1l A T 8: 114,289,392 N341Y possibly damaging Het
Vmn2r82 C G 10: 79,396,442 Y758* probably null Het
Vps16 T G 2: 130,438,179 V108G probably damaging Het
Vps53 T A 11: 76,077,074 I585F possibly damaging Het
Wrnip1 G A 13: 32,816,281 V424M probably benign Het
Yif1a G A 19: 5,089,790 V88M possibly damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfhx3 A G 8: 108,793,248 E334G probably damaging Het
Zfp277 T C 12: 40,315,853 D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 N1558K probably benign Het
Zfp3 A G 11: 70,772,073 K286R probably benign Het
Zfp366 T C 13: 99,229,515 C395R probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 splice site probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
R8365:A2ml1 UTSW 6 128580955 nonsense probably null
R8382:A2ml1 UTSW 6 128560682 missense probably benign 0.01
R8388:A2ml1 UTSW 6 128571974 missense probably benign 0.03
R8717:A2ml1 UTSW 6 128566995 missense probably benign 0.00
R8947:A2ml1 UTSW 6 128552256 missense probably damaging 1.00
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AACACAAGGATGAGCCCGTG -3'
(R):5'- GTCCCCTCTGAGTGGGTAAC -3'

Sequencing Primer
(F):5'- AGAGGACCTAGGTTCGATTCC -3'
(R):5'- CCCCTCTGAGTGGGTAACTTATAG -3'
Posted On2019-09-13