Incidental Mutation 'R7378:Apc2'
ID572500
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Nameadenomatosis polyposis coli 2
SynonymsAPCL
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R7378 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80295977-80318263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80311394 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 761 (L761I)
Ref Sequence ENSEMBL: ENSMUSP00000100996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020349
AA Change: L732I

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: L732I

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: L761I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: L761I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,546,247 probably null Het
Aars A G 8: 111,042,342 Y258C probably damaging Het
Acaa2 A T 18: 74,805,872 Y376F probably benign Het
Adcy1 C T 11: 7,169,543 S1062F possibly damaging Het
Adgrb3 A T 1: 25,531,919 C492* probably null Het
Adgrg6 A G 10: 14,535,892 F22S probably benign Het
Afm T A 5: 90,551,400 C568S probably benign Het
Ago4 C T 4: 126,511,464 E439K probably benign Het
Aifm2 T G 10: 61,727,717 V122G possibly damaging Het
Akap6 A G 12: 53,142,574 N2257S probably benign Het
Ap3m2 A G 8: 22,804,010 I8T probably benign Het
Arntl C A 7: 113,299,208 T281K probably benign Het
Asna1 A T 8: 85,019,863 F119I probably benign Het
Asxl1 T C 2: 153,401,993 C1489R probably damaging Het
Atm T G 9: 53,453,437 probably null Het
Bpifa6 C A 2: 153,986,433 A153E probably damaging Het
Cav2 A G 6: 17,282,060 T106A probably benign Het
Cavin4 A G 4: 48,663,631 N4D probably benign Het
Cenpc1 T C 5: 86,046,499 N136S probably benign Het
Crocc2 C T 1: 93,194,087 L653F probably damaging Het
Cry2 A G 2: 92,413,664 L388P probably damaging Het
Cstb T C 10: 78,426,988 F43S probably damaging Het
Ctcfl A G 2: 173,112,258 Y349H probably damaging Het
Ctu2 T A 8: 122,481,499 V485D probably damaging Het
Cwc25 A C 11: 97,747,997 L367R possibly damaging Het
Dock4 T A 12: 40,788,244 H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,752,642 V26L probably benign Het
Dusp27 G T 1: 166,112,063 S58* probably null Het
Elmo1 A T 13: 20,280,935 I225F probably benign Het
Ep300 T C 15: 81,650,545 S2268P probably damaging Het
F2r C T 13: 95,618,328 C16Y probably damaging Het
Fam126b T C 1: 58,530,034 K462R probably benign Het
Fbxo33 C A 12: 59,204,371 E453* probably null Het
Flot1 A T 17: 35,825,513 D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fras1 T C 5: 96,596,785 C560R probably damaging Het
Gfi1 A T 5: 107,723,229 S165T possibly damaging Het
Gli2 T C 1: 118,848,492 D400G probably damaging Het
Gm11639 T C 11: 104,714,702 I298T probably benign Het
Gml C T 15: 74,817,121 V27I possibly damaging Het
Htt A T 5: 34,803,799 I257F probably benign Het
Ier5 C T 1: 155,098,692 V247M probably damaging Het
Ift46 C T 9: 44,778,595 probably benign Het
Il12b A G 11: 44,407,894 T59A probably benign Het
Insr A G 8: 3,198,231 L438P probably damaging Het
Iqgap2 C T 13: 95,732,890 probably null Het
Irx4 A T 13: 73,267,553 T154S possibly damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Kcns2 T A 15: 34,839,703 L404* probably null Het
Kif2c T C 4: 117,162,029 E644G possibly damaging Het
Klhl22 T C 16: 17,776,805 L266P probably damaging Het
Krt71 T A 15: 101,738,329 K315* probably null Het
Lca5 T C 9: 83,395,530 N587S probably benign Het
Lrp1b T A 2: 41,295,669 M1459L Het
Lrrtm2 T C 18: 35,213,592 K219R probably damaging Het
Mcmbp T C 7: 128,704,517 D459G probably damaging Het
Megf8 A G 7: 25,348,942 H1680R probably damaging Het
Mia3 A G 1: 183,334,775 S301P probably benign Het
Mtrr A G 13: 68,564,402 Y622H probably damaging Het
Myo7b T A 18: 31,966,239 Q1710L probably damaging Het
Nab1 T C 1: 52,480,995 N276D probably damaging Het
Nalcn C T 14: 123,302,890 R1127H probably damaging Het
Nbas T A 12: 13,274,219 I110N probably damaging Het
Nfe2l3 C T 6: 51,457,296 Q279* probably null Het
Nlrp9c C T 7: 26,365,015 E963K probably benign Het
Nsmaf A G 4: 6,416,586 V569A probably benign Het
Olfr1066 T C 2: 86,456,068 T68A probably benign Het
Olfr1338 T C 4: 118,754,175 Y123C possibly damaging Het
Olfr199 T A 16: 59,215,920 D231V probably benign Het
Olfr273 C T 4: 52,856,421 V31I probably benign Het
Olfr481 T C 7: 108,081,192 S133P not run Het
Olfr669 A T 7: 104,939,431 I302F probably benign Het
Olfr69 T A 7: 103,767,930 I156F probably benign Het
Olfr851 T A 9: 19,497,102 M118K probably damaging Het
Olfr857 A T 9: 19,712,887 D20V probably damaging Het
Olfr933 T A 9: 38,975,721 V15E probably benign Het
Paf1 A G 7: 28,396,928 Y322C probably damaging Het
Pcdha2 C A 18: 36,939,385 A23D possibly damaging Het
Pcdhb6 G A 18: 37,335,172 C382Y probably damaging Het
Pdzd7 C T 19: 45,045,606 G13D probably damaging Het
Pik3r2 T C 8: 70,769,381 N586S probably benign Het
Pik3r3 T A 4: 116,270,830 D119E probably benign Het
Pkd2l1 T A 19: 44,153,715 I535F probably benign Het
Ppl T A 16: 5,112,996 Q53L possibly damaging Het
Rimbp3 T G 16: 17,211,204 S831A probably benign Het
Rnps1 A G 17: 24,418,530 T49A unknown Het
Rrm2b T A 15: 37,931,647 E248D probably benign Het
Sdhaf4 A G 1: 23,996,358 F70L probably damaging Het
Sel1l3 A T 5: 53,116,409 S1038R probably benign Het
Selenoo T A 15: 89,089,478 F124I probably benign Het
Setbp1 A T 18: 78,857,486 Y989N probably damaging Het
Slc1a7 A G 4: 108,002,203 E163G possibly damaging Het
Slc22a2 T C 17: 12,612,391 F356S probably damaging Het
Slc24a4 C T 12: 102,239,176 P378L probably benign Het
Slc4a1ap A G 5: 31,527,527 D169G probably benign Het
Slc4a7 T A 14: 14,757,421 V422D probably damaging Het
Slitrk6 T C 14: 110,749,863 Y804C probably damaging Het
Smarcad1 T A 6: 65,110,376 H906Q probably benign Het
Smn1 A G 13: 100,127,865 T109A probably damaging Het
Sntb2 A G 8: 106,981,312 N236S probably damaging Het
Spag9 T A 11: 94,114,351 probably null Het
Spg11 C A 2: 122,058,429 G2154W probably damaging Het
Srsf6 T C 2: 162,934,569 S278P unknown Het
Stag3 G A 5: 138,281,960 R29H probably benign Het
Stambp C T 6: 83,563,906 V98I not run Het
Suco T C 1: 161,862,211 D89G possibly damaging Het
Suox C T 10: 128,671,041 V373I probably benign Het
Sv2b T A 7: 75,147,728 probably null Het
Tatdn2 T C 6: 113,704,701 L565P probably damaging Het
Tbpl2 T A 2: 24,094,700 E145V probably benign Het
Tlr1 T C 5: 64,925,228 I669V not run Het
Tmc1 A T 19: 20,868,389 F157I probably damaging Het
Tmem26 T G 10: 68,724,092 probably null Het
Tmem33 A T 5: 67,286,133 I218F probably benign Het
Tmem94 T A 11: 115,794,174 D862E probably damaging Het
Tnr T C 1: 159,884,862 probably null Het
Tnrc6c T C 11: 117,741,780 S1103P probably benign Het
Tomm70a T A 16: 57,146,044 Y453* probably null Het
Trabd C A 15: 89,085,290 R229S possibly damaging Het
Trappc10 T C 10: 78,193,418 D1095G probably damaging Het
Trim27 A G 13: 21,192,461 T460A possibly damaging Het
Tsen54 T G 11: 115,821,705 D433E probably benign Het
Ubap2 A G 4: 41,235,515 probably null Het
Vat1l A T 8: 114,289,392 N341Y possibly damaging Het
Vmn2r82 C G 10: 79,396,442 Y758* probably null Het
Vps16 T G 2: 130,438,179 V108G probably damaging Het
Vps53 T A 11: 76,077,074 I585F possibly damaging Het
Wrnip1 G A 13: 32,816,281 V424M probably benign Het
Yif1a G A 19: 5,089,790 V88M possibly damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfhx3 A G 8: 108,793,248 E334G probably damaging Het
Zfp277 T C 12: 40,315,853 D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 N1558K probably benign Het
Zfp3 A G 11: 70,772,073 K286R probably benign Het
Zfp366 T C 13: 99,229,515 C395R probably damaging Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1579:Apc2 UTSW 10 80311345 missense probably damaging 1.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 intron probably null
R2219:Apc2 UTSW 10 80309109 missense probably benign 0.41
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 unclassified probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4886:Apc2 UTSW 10 80314213 missense probably damaging 1.00
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6572:Apc2 UTSW 10 80311779 missense probably damaging 1.00
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
R7171:Apc2 UTSW 10 80315336 missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80311156 missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80311740 missense probably damaging 1.00
R7340:Apc2 UTSW 10 80313482 missense probably benign 0.12
R7384:Apc2 UTSW 10 80312624 missense probably damaging 1.00
R7431:Apc2 UTSW 10 80302183 missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80314886 missense possibly damaging 0.72
R7743:Apc2 UTSW 10 80304915 missense probably damaging 0.99
R7759:Apc2 UTSW 10 80311196 missense probably damaging 1.00
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAACTGTTGTGGGACCTG -3'
(R):5'- CAAGGAACATAGACATCACTGCTGG -3'

Sequencing Primer
(F):5'- TGGGCATGCTACGCAAC -3'
(R):5'- ATAGACATCACTGCTGGGCTGG -3'
Posted On2019-09-13