Incidental Mutation 'R7378:Zfp277'
ID 572513
Institutional Source Beutler Lab
Gene Symbol Zfp277
Ensembl Gene ENSMUSG00000055917
Gene Name zinc finger protein 277
Synonyms NIRF4, 2410017E24Rik
MMRRC Submission 045460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7378 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 40365045-40495789 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40365852 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 539 (D539G)
Ref Sequence ENSEMBL: ENSMUSP00000064226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069637] [ENSMUST00000069692]
AlphaFold E9Q6D6
Predicted Effect possibly damaging
Transcript: ENSMUST00000069637
AA Change: D413G

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068032
Gene: ENSMUSG00000055917
AA Change: D413G

DomainStartEndE-ValueType
ZnF_C2H2 59 84 4.27e1 SMART
coiled coil region 143 171 N/A INTRINSIC
ZnF_C2H2 174 198 3.85e1 SMART
ZnF_C2H2 225 249 2.24e-3 SMART
low complexity region 280 292 N/A INTRINSIC
ZnF_C2H2 303 326 1.91e1 SMART
ZnF_C2H2 356 382 4.94e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069692
AA Change: D539G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064226
Gene: ENSMUSG00000055917
AA Change: D539G

DomainStartEndE-ValueType
ZnF_C2H2 185 210 4.27e1 SMART
coiled coil region 269 297 N/A INTRINSIC
ZnF_C2H2 300 324 3.85e1 SMART
ZnF_C2H2 351 375 2.24e-3 SMART
low complexity region 406 418 N/A INTRINSIC
ZnF_C2H2 429 452 1.91e1 SMART
ZnF_C2H2 482 508 4.94e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (138/140)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early cellular preplicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,523,210 (GRCm39) probably null Het
Aars1 A G 8: 111,768,974 (GRCm39) Y258C probably damaging Het
Acaa2 A T 18: 74,938,943 (GRCm39) Y376F probably benign Het
Adcy1 C T 11: 7,119,543 (GRCm39) S1062F possibly damaging Het
Adgrb3 A T 1: 25,571,000 (GRCm39) C492* probably null Het
Adgrg6 A G 10: 14,411,636 (GRCm39) F22S probably benign Het
Adh1 A G 3: 137,994,648 (GRCm39) probably null Het
Afm T A 5: 90,699,259 (GRCm39) C568S probably benign Het
Ago4 C T 4: 126,405,257 (GRCm39) E439K probably benign Het
Aifm2 T G 10: 61,563,496 (GRCm39) V122G possibly damaging Het
Akap6 A G 12: 53,189,357 (GRCm39) N2257S probably benign Het
Ap3m2 A G 8: 23,294,026 (GRCm39) I8T probably benign Het
Apc2 C A 10: 80,147,228 (GRCm39) L761I probably damaging Het
Asap2 A G 12: 21,162,052 (GRCm39) D3G probably benign Het
Asxl1 T C 2: 153,243,913 (GRCm39) C1489R probably damaging Het
Atm T G 9: 53,364,737 (GRCm39) probably null Het
Bmal1 C A 7: 112,898,415 (GRCm39) T281K probably benign Het
Bpifa6 C A 2: 153,828,353 (GRCm39) A153E probably damaging Het
Cav2 A G 6: 17,282,059 (GRCm39) T106A probably benign Het
Cavin4 A G 4: 48,663,631 (GRCm39) N4D probably benign Het
Cenpc1 T C 5: 86,194,358 (GRCm39) N136S probably benign Het
Cfap45 T A 1: 172,365,910 (GRCm39) probably null Het
Col3a1 G A 1: 45,366,807 (GRCm39) probably null Het
Crocc2 C T 1: 93,121,809 (GRCm39) L653F probably damaging Het
Cry2 A G 2: 92,244,009 (GRCm39) L388P probably damaging Het
Cstb T C 10: 78,262,822 (GRCm39) F43S probably damaging Het
Ctcfl A G 2: 172,954,051 (GRCm39) Y349H probably damaging Het
Ctu2 T A 8: 123,208,238 (GRCm39) V485D probably damaging Het
Cwc25 A C 11: 97,638,823 (GRCm39) L367R possibly damaging Het
Dock4 T A 12: 40,838,243 (GRCm39) H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,452,067 (GRCm39) V26L probably benign Het
Efcab3 T C 11: 104,605,528 (GRCm39) I298T probably benign Het
Elmo1 A T 13: 20,465,105 (GRCm39) I225F probably benign Het
Ep300 T C 15: 81,534,746 (GRCm39) S2268P probably damaging Het
F2r C T 13: 95,754,836 (GRCm39) C16Y probably damaging Het
Fbxo33 C A 12: 59,251,157 (GRCm39) E453* probably null Het
Flot1 A T 17: 36,136,405 (GRCm39) D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fras1 T C 5: 96,744,644 (GRCm39) C560R probably damaging Het
Get3 A T 8: 85,746,492 (GRCm39) F119I probably benign Het
Gfi1 A T 5: 107,871,095 (GRCm39) S165T possibly damaging Het
Gli2 T C 1: 118,776,222 (GRCm39) D400G probably damaging Het
Gm37240 T A 3: 84,879,944 (GRCm39) probably null Het
Gml C T 15: 74,688,970 (GRCm39) V27I possibly damaging Het
Htt A T 5: 34,961,143 (GRCm39) I257F probably benign Het
Hycc2 T C 1: 58,569,193 (GRCm39) K462R probably benign Het
Ier5 C T 1: 154,974,438 (GRCm39) V247M probably damaging Het
Ift46 C T 9: 44,689,892 (GRCm39) probably benign Het
Il12b A G 11: 44,298,721 (GRCm39) T59A probably benign Het
Insr A G 8: 3,248,231 (GRCm39) L438P probably damaging Het
Iqgap2 C T 13: 95,869,398 (GRCm39) probably null Het
Irx4 A T 13: 73,415,672 (GRCm39) T154S possibly damaging Het
Itgbl1 A G 14: 124,094,901 (GRCm39) K309E probably benign Het
Kcns2 T A 15: 34,839,849 (GRCm39) L404* probably null Het
Kif2c T C 4: 117,019,226 (GRCm39) E644G possibly damaging Het
Klhl22 T C 16: 17,594,669 (GRCm39) L266P probably damaging Het
Krt71 T A 15: 101,646,764 (GRCm39) K315* probably null Het
Lca5 T C 9: 83,277,583 (GRCm39) N587S probably benign Het
Lrp1b T A 2: 41,185,681 (GRCm39) M1459L Het
Lrrtm2 T C 18: 35,346,645 (GRCm39) K219R probably damaging Het
Mcmbp T C 7: 128,306,241 (GRCm39) D459G probably damaging Het
Megf8 A G 7: 25,048,367 (GRCm39) H1680R probably damaging Het
Mia3 A G 1: 183,115,629 (GRCm39) S301P probably benign Het
Mtrr A G 13: 68,712,521 (GRCm39) Y622H probably damaging Het
Myo7b T A 18: 32,099,292 (GRCm39) Q1710L probably damaging Het
Nab1 T C 1: 52,520,154 (GRCm39) N276D probably damaging Het
Nalcn C T 14: 123,540,302 (GRCm39) R1127H probably damaging Het
Nbas T A 12: 13,324,220 (GRCm39) I110N probably damaging Het
Nfe2l3 C T 6: 51,434,276 (GRCm39) Q279* probably null Het
Nlrp9c C T 7: 26,064,440 (GRCm39) E963K probably benign Het
Nsmaf A G 4: 6,416,586 (GRCm39) V569A probably benign Het
Or10ak14 T C 4: 118,611,372 (GRCm39) Y123C possibly damaging Het
Or13c3 C T 4: 52,856,421 (GRCm39) V31I probably benign Het
Or52a5b T A 7: 103,417,137 (GRCm39) I156F probably benign Het
Or52n5 A T 7: 104,588,638 (GRCm39) I302F probably benign Het
Or5ac17 T A 16: 59,036,283 (GRCm39) D231V probably benign Het
Or5p4 T C 7: 107,680,399 (GRCm39) S133P not run Het
Or7e166 A T 9: 19,624,183 (GRCm39) D20V probably damaging Het
Or7g32 T A 9: 19,408,398 (GRCm39) M118K probably damaging Het
Or8d1b T A 9: 38,887,017 (GRCm39) V15E probably benign Het
Or8k28 T C 2: 86,286,412 (GRCm39) T68A probably benign Het
Paf1 A G 7: 28,096,353 (GRCm39) Y322C probably damaging Het
Pcdha2 C A 18: 37,072,438 (GRCm39) A23D possibly damaging Het
Pcdhb6 G A 18: 37,468,225 (GRCm39) C382Y probably damaging Het
Pdzd7 C T 19: 45,034,045 (GRCm39) G13D probably damaging Het
Pik3r2 T C 8: 71,222,025 (GRCm39) N586S probably benign Het
Pik3r3 T A 4: 116,128,027 (GRCm39) D119E probably benign Het
Pkd2l1 T A 19: 44,142,154 (GRCm39) I535F probably benign Het
Ppfia3 T C 7: 45,010,870 (GRCm39) probably null Het
Ppl T A 16: 4,930,860 (GRCm39) Q53L possibly damaging Het
Rimbp3 T G 16: 17,029,068 (GRCm39) S831A probably benign Het
Rnps1 A G 17: 24,637,504 (GRCm39) T49A unknown Het
Rpl7a T A 2: 26,802,019 (GRCm39) probably null Het
Rrm2b T A 15: 37,931,891 (GRCm39) E248D probably benign Het
Sdhaf4 A G 1: 24,035,439 (GRCm39) F70L probably damaging Het
Sel1l3 A T 5: 53,273,751 (GRCm39) S1038R probably benign Het
Selenoo T A 15: 88,973,681 (GRCm39) F124I probably benign Het
Setbp1 A T 18: 78,900,701 (GRCm39) Y989N probably damaging Het
Slc1a7 A G 4: 107,859,400 (GRCm39) E163G possibly damaging Het
Slc22a2 T C 17: 12,831,278 (GRCm39) F356S probably damaging Het
Slc24a4 C T 12: 102,205,435 (GRCm39) P378L probably benign Het
Slc4a1ap A G 5: 31,684,871 (GRCm39) D169G probably benign Het
Slc4a7 T A 14: 14,757,421 (GRCm38) V422D probably damaging Het
Slitrk6 T C 14: 110,987,295 (GRCm39) Y804C probably damaging Het
Smarcad1 T A 6: 65,087,360 (GRCm39) H906Q probably benign Het
Smn1 A G 13: 100,264,373 (GRCm39) T109A probably damaging Het
Sntb2 A G 8: 107,707,944 (GRCm39) N236S probably damaging Het
Spag9 T A 11: 94,005,177 (GRCm39) probably null Het
Spg11 C A 2: 121,888,910 (GRCm39) G2154W probably damaging Het
Srsf6 T C 2: 162,776,489 (GRCm39) S278P unknown Het
Stag3 G A 5: 138,280,222 (GRCm39) R29H probably benign Het
Stambp C T 6: 83,540,888 (GRCm39) V98I not run Het
Styxl2 G T 1: 165,939,632 (GRCm39) S58* probably null Het
Suco T C 1: 161,689,780 (GRCm39) D89G possibly damaging Het
Suox C T 10: 128,506,910 (GRCm39) V373I probably benign Het
Sv2b T A 7: 74,797,476 (GRCm39) probably null Het
Tatdn2 T C 6: 113,681,662 (GRCm39) L565P probably damaging Het
Tbpl2 T A 2: 23,984,712 (GRCm39) E145V probably benign Het
Tlr1 T C 5: 65,082,571 (GRCm39) I669V not run Het
Tmc1 A T 19: 20,845,753 (GRCm39) F157I probably damaging Het
Tmem26 T G 10: 68,559,922 (GRCm39) probably null Het
Tmem33 A T 5: 67,443,476 (GRCm39) I218F probably benign Het
Tmem94 T A 11: 115,685,000 (GRCm39) D862E probably damaging Het
Tnr T C 1: 159,712,432 (GRCm39) probably null Het
Tnrc6c T C 11: 117,632,606 (GRCm39) S1103P probably benign Het
Tomm70a T A 16: 56,966,407 (GRCm39) Y453* probably null Het
Trabd C A 15: 88,969,493 (GRCm39) R229S possibly damaging Het
Trappc10 T C 10: 78,029,252 (GRCm39) D1095G probably damaging Het
Trim27 A G 13: 21,376,631 (GRCm39) T460A possibly damaging Het
Tsen54 T G 11: 115,712,531 (GRCm39) D433E probably benign Het
Ubap2 A G 4: 41,235,515 (GRCm39) probably null Het
Vat1l A T 8: 115,016,132 (GRCm39) N341Y possibly damaging Het
Vmn2r82 C G 10: 79,232,276 (GRCm39) Y758* probably null Het
Vps16 T G 2: 130,280,099 (GRCm39) V108G probably damaging Het
Vps53 T A 11: 75,967,900 (GRCm39) I585F possibly damaging Het
Wrnip1 G A 13: 33,000,264 (GRCm39) V424M probably benign Het
Yif1a G A 19: 5,139,818 (GRCm39) V88M possibly damaging Het
Zfat T C 15: 68,052,969 (GRCm39) Y275C probably damaging Het
Zfhx3 A G 8: 109,519,880 (GRCm39) E334G probably damaging Het
Zfp292 A T 4: 34,808,384 (GRCm39) N1558K probably benign Het
Zfp3 A G 11: 70,662,899 (GRCm39) K286R probably benign Het
Zfp366 T C 13: 99,366,023 (GRCm39) C395R probably damaging Het
Other mutations in Zfp277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Zfp277 APN 12 40,428,825 (GRCm39) missense probably benign 0.24
IGL01477:Zfp277 APN 12 40,370,675 (GRCm39) missense probably benign 0.00
IGL02081:Zfp277 APN 12 40,378,795 (GRCm39) nonsense probably null
IGL02165:Zfp277 APN 12 40,365,802 (GRCm39) missense possibly damaging 0.75
IGL02613:Zfp277 APN 12 40,379,514 (GRCm39) missense probably damaging 1.00
IGL02688:Zfp277 APN 12 40,378,687 (GRCm39) missense possibly damaging 0.95
IGL02825:Zfp277 APN 12 40,367,175 (GRCm39) missense probably benign 0.06
R0194:Zfp277 UTSW 12 40,428,876 (GRCm39) splice site probably benign
R0226:Zfp277 UTSW 12 40,414,161 (GRCm39) missense possibly damaging 0.67
R0843:Zfp277 UTSW 12 40,370,599 (GRCm39) critical splice donor site probably null
R1263:Zfp277 UTSW 12 40,414,164 (GRCm39) missense probably damaging 0.99
R1584:Zfp277 UTSW 12 40,428,825 (GRCm39) missense probably benign 0.12
R1609:Zfp277 UTSW 12 40,378,719 (GRCm39) missense probably damaging 0.99
R1644:Zfp277 UTSW 12 40,379,609 (GRCm39) splice site probably null
R1789:Zfp277 UTSW 12 40,414,084 (GRCm39) missense probably benign 0.00
R1882:Zfp277 UTSW 12 40,495,745 (GRCm39) missense probably benign 0.03
R2011:Zfp277 UTSW 12 40,367,217 (GRCm39) nonsense probably null
R4884:Zfp277 UTSW 12 40,413,152 (GRCm39) missense probably damaging 0.97
R4976:Zfp277 UTSW 12 40,378,687 (GRCm39) missense possibly damaging 0.95
R5119:Zfp277 UTSW 12 40,378,687 (GRCm39) missense possibly damaging 0.95
R5532:Zfp277 UTSW 12 40,385,308 (GRCm39) missense probably damaging 1.00
R6340:Zfp277 UTSW 12 40,368,548 (GRCm39) missense possibly damaging 0.57
R7191:Zfp277 UTSW 12 40,379,561 (GRCm39) missense probably damaging 1.00
R7446:Zfp277 UTSW 12 40,378,729 (GRCm39) missense probably damaging 1.00
R7564:Zfp277 UTSW 12 40,379,594 (GRCm39) missense probably damaging 0.99
R7861:Zfp277 UTSW 12 40,365,880 (GRCm39) missense possibly damaging 0.92
R8428:Zfp277 UTSW 12 40,379,577 (GRCm39) missense probably damaging 1.00
R9673:Zfp277 UTSW 12 40,370,611 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAAACCAGGTGACACTGTGC -3'
(R):5'- TTGTGTCAGACAGGAAGGGTC -3'

Sequencing Primer
(F):5'- TGACACTGTGCCTGCAG -3'
(R):5'- TCAACAGAGGTGTCTCCCAG -3'
Posted On 2019-09-13