Incidental Mutation 'R7378:Dock4'
ID 572514
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 045460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R7378 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40838243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1061 (H1061Q)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect possibly damaging
Transcript: ENSMUST00000037488
AA Change: H1061Q

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: H1061Q

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: H1061Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (138/140)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,523,210 (GRCm39) probably null Het
Aars1 A G 8: 111,768,974 (GRCm39) Y258C probably damaging Het
Acaa2 A T 18: 74,938,943 (GRCm39) Y376F probably benign Het
Adcy1 C T 11: 7,119,543 (GRCm39) S1062F possibly damaging Het
Adgrb3 A T 1: 25,571,000 (GRCm39) C492* probably null Het
Adgrg6 A G 10: 14,411,636 (GRCm39) F22S probably benign Het
Adh1 A G 3: 137,994,648 (GRCm39) probably null Het
Afm T A 5: 90,699,259 (GRCm39) C568S probably benign Het
Ago4 C T 4: 126,405,257 (GRCm39) E439K probably benign Het
Aifm2 T G 10: 61,563,496 (GRCm39) V122G possibly damaging Het
Akap6 A G 12: 53,189,357 (GRCm39) N2257S probably benign Het
Ap3m2 A G 8: 23,294,026 (GRCm39) I8T probably benign Het
Apc2 C A 10: 80,147,228 (GRCm39) L761I probably damaging Het
Asap2 A G 12: 21,162,052 (GRCm39) D3G probably benign Het
Asxl1 T C 2: 153,243,913 (GRCm39) C1489R probably damaging Het
Atm T G 9: 53,364,737 (GRCm39) probably null Het
Bmal1 C A 7: 112,898,415 (GRCm39) T281K probably benign Het
Bpifa6 C A 2: 153,828,353 (GRCm39) A153E probably damaging Het
Cav2 A G 6: 17,282,059 (GRCm39) T106A probably benign Het
Cavin4 A G 4: 48,663,631 (GRCm39) N4D probably benign Het
Cenpc1 T C 5: 86,194,358 (GRCm39) N136S probably benign Het
Cfap45 T A 1: 172,365,910 (GRCm39) probably null Het
Col3a1 G A 1: 45,366,807 (GRCm39) probably null Het
Crocc2 C T 1: 93,121,809 (GRCm39) L653F probably damaging Het
Cry2 A G 2: 92,244,009 (GRCm39) L388P probably damaging Het
Cstb T C 10: 78,262,822 (GRCm39) F43S probably damaging Het
Ctcfl A G 2: 172,954,051 (GRCm39) Y349H probably damaging Het
Ctu2 T A 8: 123,208,238 (GRCm39) V485D probably damaging Het
Cwc25 A C 11: 97,638,823 (GRCm39) L367R possibly damaging Het
Dpy19l3 C A 7: 35,452,067 (GRCm39) V26L probably benign Het
Efcab3 T C 11: 104,605,528 (GRCm39) I298T probably benign Het
Elmo1 A T 13: 20,465,105 (GRCm39) I225F probably benign Het
Ep300 T C 15: 81,534,746 (GRCm39) S2268P probably damaging Het
F2r C T 13: 95,754,836 (GRCm39) C16Y probably damaging Het
Fbxo33 C A 12: 59,251,157 (GRCm39) E453* probably null Het
Flot1 A T 17: 36,136,405 (GRCm39) D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fras1 T C 5: 96,744,644 (GRCm39) C560R probably damaging Het
Get3 A T 8: 85,746,492 (GRCm39) F119I probably benign Het
Gfi1 A T 5: 107,871,095 (GRCm39) S165T possibly damaging Het
Gli2 T C 1: 118,776,222 (GRCm39) D400G probably damaging Het
Gm37240 T A 3: 84,879,944 (GRCm39) probably null Het
Gml C T 15: 74,688,970 (GRCm39) V27I possibly damaging Het
Htt A T 5: 34,961,143 (GRCm39) I257F probably benign Het
Hycc2 T C 1: 58,569,193 (GRCm39) K462R probably benign Het
Ier5 C T 1: 154,974,438 (GRCm39) V247M probably damaging Het
Ift46 C T 9: 44,689,892 (GRCm39) probably benign Het
Il12b A G 11: 44,298,721 (GRCm39) T59A probably benign Het
Insr A G 8: 3,248,231 (GRCm39) L438P probably damaging Het
Iqgap2 C T 13: 95,869,398 (GRCm39) probably null Het
Irx4 A T 13: 73,415,672 (GRCm39) T154S possibly damaging Het
Itgbl1 A G 14: 124,094,901 (GRCm39) K309E probably benign Het
Kcns2 T A 15: 34,839,849 (GRCm39) L404* probably null Het
Kif2c T C 4: 117,019,226 (GRCm39) E644G possibly damaging Het
Klhl22 T C 16: 17,594,669 (GRCm39) L266P probably damaging Het
Krt71 T A 15: 101,646,764 (GRCm39) K315* probably null Het
Lca5 T C 9: 83,277,583 (GRCm39) N587S probably benign Het
Lrp1b T A 2: 41,185,681 (GRCm39) M1459L Het
Lrrtm2 T C 18: 35,346,645 (GRCm39) K219R probably damaging Het
Mcmbp T C 7: 128,306,241 (GRCm39) D459G probably damaging Het
Megf8 A G 7: 25,048,367 (GRCm39) H1680R probably damaging Het
Mia3 A G 1: 183,115,629 (GRCm39) S301P probably benign Het
Mtrr A G 13: 68,712,521 (GRCm39) Y622H probably damaging Het
Myo7b T A 18: 32,099,292 (GRCm39) Q1710L probably damaging Het
Nab1 T C 1: 52,520,154 (GRCm39) N276D probably damaging Het
Nalcn C T 14: 123,540,302 (GRCm39) R1127H probably damaging Het
Nbas T A 12: 13,324,220 (GRCm39) I110N probably damaging Het
Nfe2l3 C T 6: 51,434,276 (GRCm39) Q279* probably null Het
Nlrp9c C T 7: 26,064,440 (GRCm39) E963K probably benign Het
Nsmaf A G 4: 6,416,586 (GRCm39) V569A probably benign Het
Or10ak14 T C 4: 118,611,372 (GRCm39) Y123C possibly damaging Het
Or13c3 C T 4: 52,856,421 (GRCm39) V31I probably benign Het
Or52a5b T A 7: 103,417,137 (GRCm39) I156F probably benign Het
Or52n5 A T 7: 104,588,638 (GRCm39) I302F probably benign Het
Or5ac17 T A 16: 59,036,283 (GRCm39) D231V probably benign Het
Or5p4 T C 7: 107,680,399 (GRCm39) S133P not run Het
Or7e166 A T 9: 19,624,183 (GRCm39) D20V probably damaging Het
Or7g32 T A 9: 19,408,398 (GRCm39) M118K probably damaging Het
Or8d1b T A 9: 38,887,017 (GRCm39) V15E probably benign Het
Or8k28 T C 2: 86,286,412 (GRCm39) T68A probably benign Het
Paf1 A G 7: 28,096,353 (GRCm39) Y322C probably damaging Het
Pcdha2 C A 18: 37,072,438 (GRCm39) A23D possibly damaging Het
Pcdhb6 G A 18: 37,468,225 (GRCm39) C382Y probably damaging Het
Pdzd7 C T 19: 45,034,045 (GRCm39) G13D probably damaging Het
Pik3r2 T C 8: 71,222,025 (GRCm39) N586S probably benign Het
Pik3r3 T A 4: 116,128,027 (GRCm39) D119E probably benign Het
Pkd2l1 T A 19: 44,142,154 (GRCm39) I535F probably benign Het
Ppfia3 T C 7: 45,010,870 (GRCm39) probably null Het
Ppl T A 16: 4,930,860 (GRCm39) Q53L possibly damaging Het
Rimbp3 T G 16: 17,029,068 (GRCm39) S831A probably benign Het
Rnps1 A G 17: 24,637,504 (GRCm39) T49A unknown Het
Rpl7a T A 2: 26,802,019 (GRCm39) probably null Het
Rrm2b T A 15: 37,931,891 (GRCm39) E248D probably benign Het
Sdhaf4 A G 1: 24,035,439 (GRCm39) F70L probably damaging Het
Sel1l3 A T 5: 53,273,751 (GRCm39) S1038R probably benign Het
Selenoo T A 15: 88,973,681 (GRCm39) F124I probably benign Het
Setbp1 A T 18: 78,900,701 (GRCm39) Y989N probably damaging Het
Slc1a7 A G 4: 107,859,400 (GRCm39) E163G possibly damaging Het
Slc22a2 T C 17: 12,831,278 (GRCm39) F356S probably damaging Het
Slc24a4 C T 12: 102,205,435 (GRCm39) P378L probably benign Het
Slc4a1ap A G 5: 31,684,871 (GRCm39) D169G probably benign Het
Slc4a7 T A 14: 14,757,421 (GRCm38) V422D probably damaging Het
Slitrk6 T C 14: 110,987,295 (GRCm39) Y804C probably damaging Het
Smarcad1 T A 6: 65,087,360 (GRCm39) H906Q probably benign Het
Smn1 A G 13: 100,264,373 (GRCm39) T109A probably damaging Het
Sntb2 A G 8: 107,707,944 (GRCm39) N236S probably damaging Het
Spag9 T A 11: 94,005,177 (GRCm39) probably null Het
Spg11 C A 2: 121,888,910 (GRCm39) G2154W probably damaging Het
Srsf6 T C 2: 162,776,489 (GRCm39) S278P unknown Het
Stag3 G A 5: 138,280,222 (GRCm39) R29H probably benign Het
Stambp C T 6: 83,540,888 (GRCm39) V98I not run Het
Styxl2 G T 1: 165,939,632 (GRCm39) S58* probably null Het
Suco T C 1: 161,689,780 (GRCm39) D89G possibly damaging Het
Suox C T 10: 128,506,910 (GRCm39) V373I probably benign Het
Sv2b T A 7: 74,797,476 (GRCm39) probably null Het
Tatdn2 T C 6: 113,681,662 (GRCm39) L565P probably damaging Het
Tbpl2 T A 2: 23,984,712 (GRCm39) E145V probably benign Het
Tlr1 T C 5: 65,082,571 (GRCm39) I669V not run Het
Tmc1 A T 19: 20,845,753 (GRCm39) F157I probably damaging Het
Tmem26 T G 10: 68,559,922 (GRCm39) probably null Het
Tmem33 A T 5: 67,443,476 (GRCm39) I218F probably benign Het
Tmem94 T A 11: 115,685,000 (GRCm39) D862E probably damaging Het
Tnr T C 1: 159,712,432 (GRCm39) probably null Het
Tnrc6c T C 11: 117,632,606 (GRCm39) S1103P probably benign Het
Tomm70a T A 16: 56,966,407 (GRCm39) Y453* probably null Het
Trabd C A 15: 88,969,493 (GRCm39) R229S possibly damaging Het
Trappc10 T C 10: 78,029,252 (GRCm39) D1095G probably damaging Het
Trim27 A G 13: 21,376,631 (GRCm39) T460A possibly damaging Het
Tsen54 T G 11: 115,712,531 (GRCm39) D433E probably benign Het
Ubap2 A G 4: 41,235,515 (GRCm39) probably null Het
Vat1l A T 8: 115,016,132 (GRCm39) N341Y possibly damaging Het
Vmn2r82 C G 10: 79,232,276 (GRCm39) Y758* probably null Het
Vps16 T G 2: 130,280,099 (GRCm39) V108G probably damaging Het
Vps53 T A 11: 75,967,900 (GRCm39) I585F possibly damaging Het
Wrnip1 G A 13: 33,000,264 (GRCm39) V424M probably benign Het
Yif1a G A 19: 5,139,818 (GRCm39) V88M possibly damaging Het
Zfat T C 15: 68,052,969 (GRCm39) Y275C probably damaging Het
Zfhx3 A G 8: 109,519,880 (GRCm39) E334G probably damaging Het
Zfp277 T C 12: 40,365,852 (GRCm39) D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 (GRCm39) N1558K probably benign Het
Zfp3 A G 11: 70,662,899 (GRCm39) K286R probably benign Het
Zfp366 T C 13: 99,366,023 (GRCm39) C395R probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACTACAGAACCATCTCTCCAGTTTC -3'
(R):5'- TTGTGAAGACGCCAGACAGG -3'

Sequencing Primer
(F):5'- TGGGGCGATAACTGTAGT -3'
(R):5'- GACAGGGAAGTGACACCCC -3'
Posted On 2019-09-13