Incidental Mutation 'R7378:Slc4a7'
ID572527
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R7378 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14757421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 422 (V422D)
Ref Sequence ENSEMBL: ENSMUSP00000058313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225175] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225630] [ENSMUST00000225979] [ENSMUST00000226079]
Predicted Effect probably damaging
Transcript: ENSMUST00000057015
AA Change: V422D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: V422D

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223607
AA Change: V534D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223695
AA Change: V435D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223740
AA Change: V428D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223761
AA Change: V545D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223771
Predicted Effect probably damaging
Transcript: ENSMUST00000223981
AA Change: V547D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224049
AA Change: V415D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224222
AA Change: V534D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224333
AA Change: V553D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224672
AA Change: V538D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224752
AA Change: V539D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000225175
AA Change: V532D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225232
AA Change: V409D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225238
AA Change: V442D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225630
AA Change: V409D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225979
AA Change: V429D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000226079
AA Change: V422D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (138/140)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 142 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,546,247 probably null Het
Aars A G 8: 111,042,342 Y258C probably damaging Het
Acaa2 A T 18: 74,805,872 Y376F probably benign Het
Adcy1 C T 11: 7,169,543 S1062F possibly damaging Het
Adgrb3 A T 1: 25,531,919 C492* probably null Het
Adgrg6 A G 10: 14,535,892 F22S probably benign Het
Adh1 A G 3: 138,288,887 probably null Het
Afm T A 5: 90,551,400 C568S probably benign Het
Ago4 C T 4: 126,511,464 E439K probably benign Het
Aifm2 T G 10: 61,727,717 V122G possibly damaging Het
Akap6 A G 12: 53,142,574 N2257S probably benign Het
Ap3m2 A G 8: 22,804,010 I8T probably benign Het
Apc2 C A 10: 80,311,394 L761I probably damaging Het
Arntl C A 7: 113,299,208 T281K probably benign Het
Asap2 A G 12: 21,112,051 D3G probably benign Het
Asna1 A T 8: 85,019,863 F119I probably benign Het
Asxl1 T C 2: 153,401,993 C1489R probably damaging Het
Atm T G 9: 53,453,437 probably null Het
Bpifa6 C A 2: 153,986,433 A153E probably damaging Het
Cav2 A G 6: 17,282,060 T106A probably benign Het
Cavin4 A G 4: 48,663,631 N4D probably benign Het
Cenpc1 T C 5: 86,046,499 N136S probably benign Het
Cfap45 T A 1: 172,538,343 probably null Het
Col3a1 G A 1: 45,327,647 probably null Het
Crocc2 C T 1: 93,194,087 L653F probably damaging Het
Cry2 A G 2: 92,413,664 L388P probably damaging Het
Cstb T C 10: 78,426,988 F43S probably damaging Het
Ctcfl A G 2: 173,112,258 Y349H probably damaging Het
Ctu2 T A 8: 122,481,499 V485D probably damaging Het
Cwc25 A C 11: 97,747,997 L367R possibly damaging Het
Dock4 T A 12: 40,788,244 H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,752,642 V26L probably benign Het
Dusp27 G T 1: 166,112,063 S58* probably null Het
Elmo1 A T 13: 20,280,935 I225F probably benign Het
Ep300 T C 15: 81,650,545 S2268P probably damaging Het
F2r C T 13: 95,618,328 C16Y probably damaging Het
Fam126b T C 1: 58,530,034 K462R probably benign Het
Fbxo33 C A 12: 59,204,371 E453* probably null Het
Flot1 A T 17: 35,825,513 D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fras1 T C 5: 96,596,785 C560R probably damaging Het
Gfi1 A T 5: 107,723,229 S165T possibly damaging Het
Gli2 T C 1: 118,848,492 D400G probably damaging Het
Gm11639 T C 11: 104,714,702 I298T probably benign Het
Gm37240 T A 3: 84,972,637 probably null Het
Gml C T 15: 74,817,121 V27I possibly damaging Het
Htt A T 5: 34,803,799 I257F probably benign Het
Ier5 C T 1: 155,098,692 V247M probably damaging Het
Ift46 C T 9: 44,778,595 probably benign Het
Il12b A G 11: 44,407,894 T59A probably benign Het
Insr A G 8: 3,198,231 L438P probably damaging Het
Iqgap2 C T 13: 95,732,890 probably null Het
Irx4 A T 13: 73,267,553 T154S possibly damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Kcns2 T A 15: 34,839,703 L404* probably null Het
Kif2c T C 4: 117,162,029 E644G possibly damaging Het
Klhl22 T C 16: 17,776,805 L266P probably damaging Het
Krt71 T A 15: 101,738,329 K315* probably null Het
Lca5 T C 9: 83,395,530 N587S probably benign Het
Lrp1b T A 2: 41,295,669 M1459L Het
Lrrtm2 T C 18: 35,213,592 K219R probably damaging Het
Mcmbp T C 7: 128,704,517 D459G probably damaging Het
Megf8 A G 7: 25,348,942 H1680R probably damaging Het
Mia3 A G 1: 183,334,775 S301P probably benign Het
Mtrr A G 13: 68,564,402 Y622H probably damaging Het
Myo7b T A 18: 31,966,239 Q1710L probably damaging Het
Nab1 T C 1: 52,480,995 N276D probably damaging Het
Nalcn C T 14: 123,302,890 R1127H probably damaging Het
Nbas T A 12: 13,274,219 I110N probably damaging Het
Nfe2l3 C T 6: 51,457,296 Q279* probably null Het
Nlrp9c C T 7: 26,365,015 E963K probably benign Het
Nsmaf A G 4: 6,416,586 V569A probably benign Het
Olfr1066 T C 2: 86,456,068 T68A probably benign Het
Olfr1338 T C 4: 118,754,175 Y123C possibly damaging Het
Olfr199 T A 16: 59,215,920 D231V probably benign Het
Olfr273 C T 4: 52,856,421 V31I probably benign Het
Olfr481 T C 7: 108,081,192 S133P not run Het
Olfr669 A T 7: 104,939,431 I302F probably benign Het
Olfr69 T A 7: 103,767,930 I156F probably benign Het
Olfr851 T A 9: 19,497,102 M118K probably damaging Het
Olfr857 A T 9: 19,712,887 D20V probably damaging Het
Olfr933 T A 9: 38,975,721 V15E probably benign Het
Paf1 A G 7: 28,396,928 Y322C probably damaging Het
Pcdha2 C A 18: 36,939,385 A23D possibly damaging Het
Pcdhb6 G A 18: 37,335,172 C382Y probably damaging Het
Pdzd7 C T 19: 45,045,606 G13D probably damaging Het
Pik3r2 T C 8: 70,769,381 N586S probably benign Het
Pik3r3 T A 4: 116,270,830 D119E probably benign Het
Pkd2l1 T A 19: 44,153,715 I535F probably benign Het
Ppfia3 T C 7: 45,361,446 probably null Het
Ppl T A 16: 5,112,996 Q53L possibly damaging Het
Rimbp3 T G 16: 17,211,204 S831A probably benign Het
Rnps1 A G 17: 24,418,530 T49A unknown Het
Rpl7a T A 2: 26,912,007 probably null Het
Rrm2b T A 15: 37,931,647 E248D probably benign Het
Sdhaf4 A G 1: 23,996,358 F70L probably damaging Het
Sel1l3 A T 5: 53,116,409 S1038R probably benign Het
Selenoo T A 15: 89,089,478 F124I probably benign Het
Setbp1 A T 18: 78,857,486 Y989N probably damaging Het
Slc1a7 A G 4: 108,002,203 E163G possibly damaging Het
Slc22a2 T C 17: 12,612,391 F356S probably damaging Het
Slc24a4 C T 12: 102,239,176 P378L probably benign Het
Slc4a1ap A G 5: 31,527,527 D169G probably benign Het
Slitrk6 T C 14: 110,749,863 Y804C probably damaging Het
Smarcad1 T A 6: 65,110,376 H906Q probably benign Het
Smn1 A G 13: 100,127,865 T109A probably damaging Het
Sntb2 A G 8: 106,981,312 N236S probably damaging Het
Spag9 T A 11: 94,114,351 probably null Het
Spg11 C A 2: 122,058,429 G2154W probably damaging Het
Srsf6 T C 2: 162,934,569 S278P unknown Het
Stag3 G A 5: 138,281,960 R29H probably benign Het
Stambp C T 6: 83,563,906 V98I not run Het
Suco T C 1: 161,862,211 D89G possibly damaging Het
Suox C T 10: 128,671,041 V373I probably benign Het
Sv2b T A 7: 75,147,728 probably null Het
Tatdn2 T C 6: 113,704,701 L565P probably damaging Het
Tbpl2 T A 2: 24,094,700 E145V probably benign Het
Tlr1 T C 5: 64,925,228 I669V not run Het
Tmc1 A T 19: 20,868,389 F157I probably damaging Het
Tmem26 T G 10: 68,724,092 probably null Het
Tmem33 A T 5: 67,286,133 I218F probably benign Het
Tmem94 T A 11: 115,794,174 D862E probably damaging Het
Tnr T C 1: 159,884,862 probably null Het
Tnrc6c T C 11: 117,741,780 S1103P probably benign Het
Tomm70a T A 16: 57,146,044 Y453* probably null Het
Trabd C A 15: 89,085,290 R229S possibly damaging Het
Trappc10 T C 10: 78,193,418 D1095G probably damaging Het
Trim27 A G 13: 21,192,461 T460A possibly damaging Het
Tsen54 T G 11: 115,821,705 D433E probably benign Het
Ubap2 A G 4: 41,235,515 probably null Het
Vat1l A T 8: 114,289,392 N341Y possibly damaging Het
Vmn2r82 C G 10: 79,396,442 Y758* probably null Het
Vps16 T G 2: 130,438,179 V108G probably damaging Het
Vps53 T A 11: 76,077,074 I585F possibly damaging Het
Wrnip1 G A 13: 32,816,281 V424M probably benign Het
Yif1a G A 19: 5,089,790 V88M possibly damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfhx3 A G 8: 108,793,248 E334G probably damaging Het
Zfp277 T C 12: 40,315,853 D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 N1558K probably benign Het
Zfp3 A G 11: 70,772,073 K286R probably benign Het
Zfp366 T C 13: 99,229,515 C395R probably damaging Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1128:Slc4a7 UTSW 14 14733832 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4368:Slc4a7 UTSW 14 14733775 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4592:Slc4a7 UTSW 14 14778850 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6065:Slc4a7 UTSW 14 14739836 missense probably benign 0.29
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7646:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7647:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7648:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7650:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7857:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7892:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7940:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7975:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCACTGTAAAATCTCTCTACTCAG -3'
(R):5'- GTGGTACATCCTGTCTGATGC -3'

Sequencing Primer
(F):5'- GATCGTAATGACCTCCTATCTG -3'
(R):5'- GTCTGATGCACCACCACTG -3'
Posted On2019-09-13