Incidental Mutation 'R7379:Olfr1410'
ID572557
Institutional Source Beutler Lab
Gene Symbol Olfr1410
Ensembl Gene ENSMUSG00000063583
Gene Nameolfactory receptor 1410
SynonymsMOR208-2, GA_x6K02T2R7CC-81146179-81145211
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7379 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location92605782-92614806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92608467 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 210 (C210F)
Ref Sequence ENSEMBL: ENSMUSP00000078720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079790] [ENSMUST00000216553] [ENSMUST00000217316]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079790
AA Change: C210F

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078720
Gene: ENSMUSG00000063583
AA Change: C210F

DomainStartEndE-ValueType
Pfam:7tm_4 38 314 2.6e-50 PFAM
Pfam:7tm_1 48 302 9.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216553
AA Change: C210F

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217316
AA Change: C210F

PolyPhen 2 Score 0.761 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Other mutations in Olfr1410
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02310:Olfr1410 APN 1 92608065 missense possibly damaging 0.80
R0189:Olfr1410 UTSW 1 92607893 missense probably damaging 0.99
R0520:Olfr1410 UTSW 1 92608749 missense probably damaging 1.00
R0605:Olfr1410 UTSW 1 92607896 missense probably benign 0.02
R1568:Olfr1410 UTSW 1 92607954 missense probably damaging 1.00
R1753:Olfr1410 UTSW 1 92608400 missense probably benign 0.07
R1778:Olfr1410 UTSW 1 92608109 missense possibly damaging 0.88
R2960:Olfr1410 UTSW 1 92608328 missense probably benign 0.00
R4206:Olfr1410 UTSW 1 92608595 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTGCCCTATGACCTGTGC -3'
(R):5'- TTGCTCCATGGATGCCACAC -3'

Sequencing Primer
(F):5'- ATGACCTGTGCCCGTCTTG -3'
(R):5'- TCCTGGCTGGCCATATATAACAAAG -3'
Posted On2019-09-13