Incidental Mutation 'R7379:Olfr1255'
ID572560
Institutional Source Beutler Lab
Gene Symbol Olfr1255
Ensembl Gene ENSMUSG00000045148
Gene Nameolfactory receptor 1255
SynonymsGA_x6K02T2Q125-51257221-51258135, MOR232-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7379 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89812051-89817860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89816689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 115 (V115E)
Ref Sequence ENSEMBL: ENSMUSP00000150299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057369] [ENSMUST00000214508]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057369
AA Change: V121E

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060602
Gene: ENSMUSG00000045148
AA Change: V121E

DomainStartEndE-ValueType
Pfam:7tm_4 35 309 5.2e-44 PFAM
Pfam:7tm_1 45 291 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214508
AA Change: V115E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Olfr1255
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Olfr1255 APN 2 89816673 missense probably damaging 1.00
IGL02902:Olfr1255 APN 2 89817164 nonsense probably null
IGL03077:Olfr1255 APN 2 89817142 missense probably damaging 1.00
IGL03087:Olfr1255 APN 2 89816671 missense probably damaging 1.00
IGL03371:Olfr1255 APN 2 89817165 missense possibly damaging 0.64
R0683:Olfr1255 UTSW 2 89817178 missense probably damaging 1.00
R1428:Olfr1255 UTSW 2 89816381 missense probably damaging 1.00
R1567:Olfr1255 UTSW 2 89817184 missense probably damaging 1.00
R3810:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R3812:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R4900:Olfr1255 UTSW 2 89816968 missense possibly damaging 0.58
R5538:Olfr1255 UTSW 2 89816620 missense probably damaging 1.00
R5770:Olfr1255 UTSW 2 89816549 missense probably damaging 1.00
R5894:Olfr1255 UTSW 2 89817213 missense possibly damaging 0.59
R5942:Olfr1255 UTSW 2 89816340 nonsense probably null
R6263:Olfr1255 UTSW 2 89816760 missense probably damaging 1.00
R6271:Olfr1255 UTSW 2 89816562 missense probably damaging 0.99
R6651:Olfr1255 UTSW 2 89816896 missense probably benign 0.13
R7298:Olfr1255 UTSW 2 89816521 missense probably damaging 0.98
R7465:Olfr1255 UTSW 2 89816536 missense probably damaging 1.00
R7546:Olfr1255 UTSW 2 89817019 missense probably benign 0.00
R7546:Olfr1255 UTSW 2 89817194 missense probably damaging 0.99
R8458:Olfr1255 UTSW 2 89817150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAACCTGCTCATTGTGGTC -3'
(R):5'- TATGATGTTGGGGCCACAG -3'

Sequencing Primer
(F):5'- TGTCATCAACAGCCAGGCTCTG -3'
(R):5'- TGTTGGGGCCACAGAAGGG -3'
Posted On2019-09-13