Incidental Mutation 'R7379:Rngtt'
ID572566
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7379 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33498981 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 513 (K513*)
Ref Sequence ENSEMBL: ENSMUSP00000103788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
PDB Structure
CRYSTAL STRUCTURE OF THE RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE OXIDIZED RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000029942
AA Change: K513*
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: K513*

DomainStartEndE-ValueType
Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108153
AA Change: K513*
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: K513*

DomainStartEndE-ValueType
Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1645:Rngtt UTSW 4 33362939 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 splice site probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R2844:Rngtt UTSW 4 33368678 missense probably benign
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R5248:Rngtt UTSW 4 33325110 nonsense probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R6571:Rngtt UTSW 4 33379413 missense probably damaging 1.00
R7260:Rngtt UTSW 4 33356176 missense possibly damaging 0.52
R7298:Rngtt UTSW 4 33362927 missense probably damaging 1.00
R8163:Rngtt UTSW 4 33325109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGTGCACCATATCTTCAGG -3'
(R):5'- TCCAGGCCTGACTACCTAAC -3'

Sequencing Primer
(F):5'- GCACCATATCTTCAGGCTTGATTAG -3'
(R):5'- TGACTACCTAACCCATTATTCAGG -3'
Posted On2019-09-13