Incidental Mutation 'R7379:Ccdc149'
ID572570
Institutional Source Beutler Lab
Gene Symbol Ccdc149
Ensembl Gene ENSMUSG00000045790
Gene Namecoiled-coil domain containing 149
SynonymsGm447, LOC242997
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7379 (G1)
Quality Score217.009
Status Validated
Chromosome5
Chromosomal Location52374651-52471521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52405066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 206 (I206T)
Ref Sequence ENSEMBL: ENSMUSP00000062411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059428] [ENSMUST00000198008]
Predicted Effect probably damaging
Transcript: ENSMUST00000059428
AA Change: I206T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062411
Gene: ENSMUSG00000045790
AA Change: I206T

DomainStartEndE-ValueType
Pfam:DUF2353 21 333 3.5e-117 PFAM
low complexity region 388 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198008
SMART Domains Protein: ENSMUSP00000143041
Gene: ENSMUSG00000045790

DomainStartEndE-ValueType
Pfam:DUF2353 21 138 1.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213027
AA Change: I19T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Ccdc149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Ccdc149 APN 5 52376322 missense probably benign 0.15
IGL02002:Ccdc149 APN 5 52406079 missense probably damaging 1.00
pequeno UTSW 5 52405133 nonsense probably null
R0226:Ccdc149 UTSW 5 52400217 missense probably damaging 1.00
R0420:Ccdc149 UTSW 5 52400239 splice site probably benign
R0959:Ccdc149 UTSW 5 52385155 missense probably damaging 1.00
R2075:Ccdc149 UTSW 5 52439168 missense probably damaging 1.00
R2355:Ccdc149 UTSW 5 52420772 missense probably damaging 0.99
R4755:Ccdc149 UTSW 5 52404151 missense probably damaging 0.96
R5596:Ccdc149 UTSW 5 52404151 missense probably damaging 0.96
R5955:Ccdc149 UTSW 5 52376535 missense probably benign 0.00
R5993:Ccdc149 UTSW 5 52402775 missense probably damaging 1.00
R6351:Ccdc149 UTSW 5 52385135 missense probably benign
R6742:Ccdc149 UTSW 5 52405133 nonsense probably null
R6939:Ccdc149 UTSW 5 52376265 missense probably benign 0.00
R6963:Ccdc149 UTSW 5 52439097 missense probably damaging 1.00
R7715:Ccdc149 UTSW 5 52404191 critical splice acceptor site probably null
R7920:Ccdc149 UTSW 5 52405094 missense probably damaging 0.98
R8154:Ccdc149 UTSW 5 52385104 critical splice donor site probably null
R8489:Ccdc149 UTSW 5 52376657 missense probably benign 0.01
R8791:Ccdc149 UTSW 5 52439210 missense probably damaging 1.00
Z1176:Ccdc149 UTSW 5 52420813 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGGCAGGGTTTCAGGGATAC -3'
(R):5'- GAAGCTCTGTGACATTCCTTGG -3'

Sequencing Primer
(F):5'- GCACGCACACACACACG -3'
(R):5'- CATTCCTTGGATTTCAGATAGAGTCG -3'
Posted On2019-09-13