Incidental Mutation 'R7379:Kit'
ID572571
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7379 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75647752 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 719 (S719C)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005815
AA Change: S719C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: S719C

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144270
AA Change: S715C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: S715C

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7810:Kit UTSW 5 75609322 missense probably benign 0.11
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8290:Kit UTSW 5 75641169 missense probably benign
R8829:Kit UTSW 5 75639131 missense probably benign 0.41
R8832:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCCACAGAACCTGATTTTGAAAC -3'
(R):5'- GAAAGAGGCACAATCCCTGC -3'

Sequencing Primer
(F):5'- ACTTTATTCAAGGCTTGCATTGC -3'
(R):5'- GGGTACCCACCTATTCTT -3'
Posted On2019-09-13