Incidental Mutation 'R7379:Mug2'
ID572577
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7379 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122047487 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 506 (E506G)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081777
AA Change: E506G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: E506G

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.3158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCACACTCTCACATGTG -3'
(R):5'- TTGGGACCCTGAGACTTTTCTG -3'

Sequencing Primer
(F):5'- GTGCAGACTACTTTCAGCAGAGTC -3'
(R):5'- ACCCTGAGACTTTTCTGAAGGTTG -3'
Posted On2019-09-13