Incidental Mutation 'R7379:Itpkc'
ID 572578
Institutional Source Beutler Lab
Gene Symbol Itpkc
Ensembl Gene ENSMUSG00000003752
Gene Name inositol 1,4,5-trisphosphate 3-kinase C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock # R7379 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 27207172-27228661 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27227769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 240 (I240K)
Ref Sequence ENSEMBL: ENSMUSP00000003850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003850]
AlphaFold Q7TS72
Predicted Effect probably benign
Transcript: ENSMUST00000003850
AA Change: I240K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: I240K

DomainStartEndE-ValueType
low complexity region 28 59 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:IPK 462 673 3.7e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Itpkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Itpkc APN 7 27213066 unclassified probably benign
IGL01774:Itpkc APN 7 27212370 missense probably benign 0.05
IGL02134:Itpkc APN 7 27227875 nonsense probably null
IGL02719:Itpkc APN 7 27228050 missense possibly damaging 0.92
R0284:Itpkc UTSW 7 27214543 nonsense probably null
R0364:Itpkc UTSW 7 27227749 missense possibly damaging 0.80
R0403:Itpkc UTSW 7 27208345 missense probably benign 0.01
R1175:Itpkc UTSW 7 27227770 missense probably benign 0.00
R1676:Itpkc UTSW 7 27208281 missense probably damaging 1.00
R1813:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1896:Itpkc UTSW 7 27208380 missense probably damaging 1.00
R1944:Itpkc UTSW 7 27227659 missense possibly damaging 0.55
R2142:Itpkc UTSW 7 27219650 missense possibly damaging 0.83
R3030:Itpkc UTSW 7 27212308 splice site probably null
R3738:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3739:Itpkc UTSW 7 27227604 missense possibly damaging 0.95
R3754:Itpkc UTSW 7 27228432 missense probably damaging 1.00
R3851:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3852:Itpkc UTSW 7 27227612 missense probably benign 0.00
R3916:Itpkc UTSW 7 27228303 missense probably benign 0.09
R3963:Itpkc UTSW 7 27227509 missense probably damaging 1.00
R5770:Itpkc UTSW 7 27212988 missense probably damaging 1.00
R5943:Itpkc UTSW 7 27212979 missense possibly damaging 0.69
R6012:Itpkc UTSW 7 27228065 missense probably damaging 0.98
R6835:Itpkc UTSW 7 27227815 missense probably benign 0.02
R7107:Itpkc UTSW 7 27228277 missense probably benign 0.15
R8305:Itpkc UTSW 7 27214519 missense probably damaging 1.00
R8365:Itpkc UTSW 7 27212352 missense probably damaging 1.00
R9216:Itpkc UTSW 7 27228004 missense probably benign 0.19
R9634:Itpkc UTSW 7 27214455 missense probably benign 0.29
R9764:Itpkc UTSW 7 27227797 missense probably benign 0.00
Z1176:Itpkc UTSW 7 27227638 missense probably benign 0.01
Z1177:Itpkc UTSW 7 27227781 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGTCACCAACTCTCCAGGC -3'
(R):5'- GACAGATCCGATATGTGGCAGAC -3'

Sequencing Primer
(F):5'- CTCCAGGCTCTGATAAATCTAATGG -3'
(R):5'- AACAAGCCCAGGGTTGAT -3'
Posted On 2019-09-13