Mutagenetix > Incidental Mutation

Incidental Mutation 'R7379:Sorcs3'

572600

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

045461-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7379 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48194464-48793944 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48760705 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 911 (V911A)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078880
AA Change: V911A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V911A

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	G	A	17: 66,292,242 (GRCm39)	R1064*	probably null	Het
Ccdc149	A	G	5: 52,562,408 (GRCm39)	I206T	probably damaging	Het
Ctu1	AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG	AGGACCGGGCAGGAGCCACCTGTGTATCGCAG	7: 43,326,490 (GRCm39)		probably benign	Het
Cyp2j6	T	C	4: 96,414,183 (GRCm39)	T361A	probably damaging	Het
Cyp4a14	A	T	4: 115,350,907 (GRCm39)		probably null	Het
Cyp7b1	A	G	3: 18,151,538 (GRCm39)	V225A	probably benign	Het
Esf1	A	G	2: 139,996,854 (GRCm39)	I503T	probably benign	Het
Flrt2	G	A	12: 95,747,329 (GRCm39)	V556I	possibly damaging	Het
Gaa	T	C	11: 119,174,525 (GRCm39)	S791P	probably benign	Het
H2-T22	A	G	17: 36,353,232 (GRCm39)		probably null	Het
Hexb	A	G	13: 97,317,672 (GRCm39)	S342P	probably damaging	Het
Ift122	C	T	6: 115,903,263 (GRCm39)	R1176C	probably benign	Het
Ift57	A	G	16: 49,581,357 (GRCm39)	E341G	probably damaging	Het
Itpkc	A	T	7: 26,927,194 (GRCm39)	I240K	probably benign	Het
Kit	A	T	5: 75,808,412 (GRCm39)	S719C	probably damaging	Het
Klf1	T	A	8: 85,629,846 (GRCm39)	Y224N	possibly damaging	Het
Krt77	T	C	15: 101,769,709 (GRCm39)	E387G	probably damaging	Het
L3mbtl1	T	A	2: 162,802,899 (GRCm39)	D347E	probably damaging	Het
Map1s	A	G	8: 71,366,219 (GRCm39)	T375A	possibly damaging	Het
Mturn	A	G	6: 54,666,069 (GRCm39)	T81A	possibly damaging	Het
Mug2	A	G	6: 122,024,446 (GRCm39)	E506G	possibly damaging	Het
Notch1	A	G	2: 26,369,479 (GRCm39)	F512S	probably damaging	Het
Or10g1	T	C	14: 52,647,718 (GRCm39)	T204A	probably benign	Het
Or12e13	T	A	2: 87,664,123 (GRCm39)	C247S	probably damaging	Het
Or4c12b	T	A	2: 89,647,033 (GRCm39)	V115E	probably benign	Het
Or9s14	G	T	1: 92,536,189 (GRCm39)	C210F	possibly damaging	Het
Pcdhga10	A	G	18: 37,880,619 (GRCm39)	N127D	probably damaging	Het
Plb1	A	G	5: 32,502,983 (GRCm39)	I1148V	probably damaging	Het
Plcb1	A	G	2: 135,212,430 (GRCm39)	D1007G	probably benign	Het
Prdm16	T	A	4: 154,613,316 (GRCm39)	E37V	probably damaging	Het
Prss45	C	A	9: 110,668,261 (GRCm39)	N151K	possibly damaging	Het
Rngtt	A	T	4: 33,498,981 (GRCm39)	K513*	probably null	Het
Serpinb10	T	C	1: 107,460,117 (GRCm39)		probably benign	Het
Shc1	T	C	3: 89,334,129 (GRCm39)	V402A	probably benign	Het
Slc25a38	T	A	9: 119,949,902 (GRCm39)	L227Q	probably benign	Het
Slc6a13	A	T	6: 121,313,798 (GRCm39)	K514*	probably null	Het
Sptb	A	T	12: 76,657,651 (GRCm39)	I1290N	probably damaging	Het
Sptbn1	T	C	11: 30,089,292 (GRCm39)	K657E	possibly damaging	Het
Stpg4	T	A	17: 87,735,068 (GRCm39)		probably null	Het
Stx2	A	G	5: 129,064,863 (GRCm39)	V278A	possibly damaging	Het
Thoc1	A	T	18: 9,992,902 (GRCm39)	N558I	probably benign	Het
Trpm2	T	C	10: 77,750,568 (GRCm39)	T1343A	probably benign	Het
Usf3	T	A	16: 44,040,939 (GRCm39)	D1806E	probably benign	Het
Vmn2r106	C	T	17: 20,488,037 (GRCm39)	M787I	possibly damaging	Het
Wdfy4	A	G	14: 32,873,566 (GRCm39)	S248P		Het
Zeb2	G	T	2: 44,891,829 (GRCm39)		probably null	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48,672,097 (GRCm39)	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48,736,758 (GRCm39)	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48,592,303 (GRCm39)	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48,755,542 (GRCm39)	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48,784,814 (GRCm39)	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48,778,570 (GRCm39)	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48,782,607 (GRCm39)	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48,523,970 (GRCm39)	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48,642,511 (GRCm39)	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48,692,809 (GRCm39)	splice site	probably benign
IGL02830:Sorcs3	APN	19	48,711,441 (GRCm39)	splice site	probably null
IGL02943:Sorcs3	APN	19	48,748,377 (GRCm39)	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48,592,333 (GRCm39)	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48,642,483 (GRCm39)	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48,736,758 (GRCm39)	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48,785,956 (GRCm39)	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48,791,137 (GRCm39)	nonsense	probably null
R0646:Sorcs3	UTSW	19	48,194,734 (GRCm39)	missense	probably benign	0.10
R0709:Sorcs3	UTSW	19	48,475,845 (GRCm39)	missense	probably benign
R0792:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48,682,433 (GRCm39)	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48,475,833 (GRCm39)	missense	probably benign
R1253:Sorcs3	UTSW	19	48,195,175 (GRCm39)	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48,682,440 (GRCm39)	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48,694,448 (GRCm39)	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48,752,620 (GRCm39)	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48,736,798 (GRCm39)	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48,592,314 (GRCm39)	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48,782,713 (GRCm39)	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48,387,150 (GRCm39)	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48,592,343 (GRCm39)	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48,711,395 (GRCm39)	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48,701,943 (GRCm39)	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48,737,812 (GRCm39)	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48,682,353 (GRCm39)	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48,672,036 (GRCm39)	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48,782,602 (GRCm39)	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48,387,183 (GRCm39)	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48,752,587 (GRCm39)	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48,748,390 (GRCm39)	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48,748,284 (GRCm39)	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48,784,911 (GRCm39)	splice site	probably null
R5848:Sorcs3	UTSW	19	48,776,950 (GRCm39)	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48,737,835 (GRCm39)	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48,784,889 (GRCm39)	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48,387,136 (GRCm39)	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48,748,296 (GRCm39)	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48,778,605 (GRCm39)	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48,791,198 (GRCm39)	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48,752,746 (GRCm39)	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48,776,944 (GRCm39)	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48,702,010 (GRCm39)	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48,682,263 (GRCm39)	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48,737,782 (GRCm39)	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48,694,402 (GRCm39)	missense	probably damaging	1.00
R7953:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48,752,734 (GRCm39)	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48,692,808 (GRCm39)	splice site	probably null
R8433:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48,194,913 (GRCm39)	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48,784,908 (GRCm39)	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48,737,810 (GRCm39)	nonsense	probably null
R9051:Sorcs3	UTSW	19	48,194,809 (GRCm39)	missense	probably benign
R9119:Sorcs3	UTSW	19	48,642,433 (GRCm39)	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48,784,811 (GRCm39)	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48,785,950 (GRCm39)	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48,711,364 (GRCm39)	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48,711,363 (GRCm39)	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48,760,728 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48,634,243 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48,692,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCCCAGCATTTTAGCAC -3'
(R):5'- ATACTAGAATTGCATGCCCAGTTC -3'

Sequencing Primer
(F):5'- GCCCAGCATTTTAGCACTTGTG -3'
(R):5'- CGCCAGAGCATAGGAATCTAGATC -3'

Posted On

2019-09-13