Incidental Mutation 'R7380:Khdrbs2'
ID572601
Institutional Source Beutler Lab
Gene Symbol Khdrbs2
Ensembl Gene ENSMUSG00000026058
Gene NameKH domain containing, RNA binding, signal transduction associated 2
Synonyms6330586C16Rik, SLM-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7380 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location32172714-32658568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32333604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 120 (S120P)
Ref Sequence ENSEMBL: ENSMUSP00000140157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027226] [ENSMUST00000188257]
Predicted Effect probably benign
Transcript: ENSMUST00000027226
SMART Domains Protein: ENSMUSP00000027226
Gene: ENSMUSG00000026058

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 156 4.93e-7 SMART
low complexity region 185 197 N/A INTRINSIC
low complexity region 204 231 N/A INTRINSIC
Pfam:Sam68-YY 267 321 1.3e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000188257
AA Change: S120P
SMART Domains Protein: ENSMUSP00000140157
Gene: ENSMUSG00000026058
AA Change: S120P

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
KH 58 122 4.04e-3 SMART
low complexity region 180 191 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is similar to the src associated in mitosis, 68 kDa protein, which is an RNA-binding protein and a substrate for Src-family tyrosine kinases during mitosis. This protein has a KH RNA-binding motif and proline-rich motifs which may be SH2 and SH3 domain binding sites. A similar rat protein is an RNA-binding protein which is tyrosine phosphorylated by Src during mitosis. These studies also suggest that the rat protein may function as an adaptor protein for Src by binding the SH2 and SH3 domains of various other proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals display smaller brain size and reduced weight in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Naa15 T G 3: 51,459,847 probably null Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr396-ps1 T A 11: 73,928,187 Y61N possibly damaging Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Khdrbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Khdrbs2 APN 1 32472752 missense probably benign 0.00
IGL01326:Khdrbs2 APN 1 32657477 missense possibly damaging 0.94
IGL01767:Khdrbs2 APN 1 32619176 nonsense probably null
IGL01792:Khdrbs2 APN 1 32657467 missense probably damaging 0.99
IGL01839:Khdrbs2 APN 1 32414862 splice site probably benign
R0046:Khdrbs2 UTSW 1 32619202 missense possibly damaging 0.56
R0079:Khdrbs2 UTSW 1 32519915 intron probably null
R0396:Khdrbs2 UTSW 1 32519973 missense probably damaging 1.00
R0613:Khdrbs2 UTSW 1 32657522 missense possibly damaging 0.94
R0616:Khdrbs2 UTSW 1 32467775 missense possibly damaging 0.65
R1034:Khdrbs2 UTSW 1 32467791 missense probably damaging 1.00
R1055:Khdrbs2 UTSW 1 32644157 splice site probably benign
R1156:Khdrbs2 UTSW 1 32467875 missense probably benign 0.04
R1456:Khdrbs2 UTSW 1 32520696 missense possibly damaging 0.71
R2007:Khdrbs2 UTSW 1 32520548 missense probably benign 0.04
R2079:Khdrbs2 UTSW 1 32467874 missense probably benign
R2384:Khdrbs2 UTSW 1 32519895 missense probably damaging 0.97
R3123:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3124:Khdrbs2 UTSW 1 32519777 missense probably damaging 0.98
R3772:Khdrbs2 UTSW 1 32244076 nonsense probably null
R4078:Khdrbs2 UTSW 1 32519814 intron probably benign
R4088:Khdrbs2 UTSW 1 32333524 missense probably damaging 1.00
R4955:Khdrbs2 UTSW 1 32520077 intron probably benign
R5465:Khdrbs2 UTSW 1 32619174 missense probably damaging 1.00
R5668:Khdrbs2 UTSW 1 32467770 missense probably damaging 1.00
R5792:Khdrbs2 UTSW 1 32472692 missense probably damaging 1.00
R6639:Khdrbs2 UTSW 1 32467862 nonsense probably null
R7027:Khdrbs2 UTSW 1 32414916 missense probably benign 0.02
R7381:Khdrbs2 UTSW 1 32333802 missense not run
X0020:Khdrbs2 UTSW 1 32414974 missense probably damaging 1.00
Z1088:Khdrbs2 UTSW 1 32244055 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGTACACCTCATAACTTCTCAATG -3'
(R):5'- CACAGGAACTATGTCCTGAGAAG -3'

Sequencing Primer
(F):5'- TTTCTCTTTCTTAACTCACACATGC -3'
(R):5'- ACTATGTCCTGAGAAGGAGGC -3'
Posted On2019-09-13