Incidental Mutation 'R7380:Nbeal1'
ID572602
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7380 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60244810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 841 (I841N)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834]
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: I841N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: I841N

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Naa15 T G 3: 51,459,847 probably null Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr396-ps1 T A 11: 73,928,187 Y61N possibly damaging Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 unclassified probably null
Lampoon UTSW 1 60261586 critical splice donor site probably null
lawyer UTSW 1 60310224 nonsense probably null
magistrate UTSW 1 60194597 critical splice donor site probably null
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
stiggs UTSW 1 60237151 missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60310224 nonsense probably null
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60217196 missense probably benign 0.39
R7414:Nbeal1 UTSW 1 60194597 critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60261584 missense probably benign
R7507:Nbeal1 UTSW 1 60235467 missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60277227 missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60244824 missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60257450 missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60319341 missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60291889 missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60260432 missense probably benign
R7902:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R7974:Nbeal1 UTSW 1 60260432 missense probably benign
R7985:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60260272 nonsense probably null
R8053:Nbeal1 UTSW 1 60279795 missense not run
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGACCTGCTTACATGCCCC -3'
(R):5'- AGAATATCCTGTGTCCAGTTCC -3'

Sequencing Primer
(F):5'- TGCTTACATGCCCCCACACAG -3'
(R):5'- ATCCTGTGTCCAGTTCCTATTATTC -3'
Posted On2019-09-13