Incidental Mutation 'R7380:Mllt3'
ID 572616
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7380 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 87769925-88033364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87791943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 415 (D415G)
Ref Sequence ENSEMBL: ENSMUSP00000077232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000126353] [ENSMUST00000148059] [ENSMUST00000149357]
AlphaFold A2AM29
Predicted Effect possibly damaging
Transcript: ENSMUST00000078090
AA Change: D415G

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496
AA Change: D415G

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect unknown
Transcript: ENSMUST00000126353
AA Change: D8G
SMART Domains Protein: ENSMUSP00000129523
Gene: ENSMUSG00000028496
AA Change: D8G

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 138 1e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000148059
SMART Domains Protein: ENSMUSP00000131095
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
PDB:2LM0|A 1 54 6e-34 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000149357
AA Change: D8G

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128366
Gene: ENSMUSG00000028496
AA Change: D8G

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
PDB:2LM0|A 76 162 4e-54 PDB
Meta Mutation Damage Score 0.1207 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Naa15 T G 3: 51,459,847 probably null Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr396-ps1 T A 11: 73,928,187 Y61N possibly damaging Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87774087 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 splice site probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R6629:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
R8871:Mllt3 UTSW 4 87841315 utr 3 prime probably benign
R9281:Mllt3 UTSW 4 87789329 missense probably benign 0.12
R9300:Mllt3 UTSW 4 87774047 nonsense probably null
R9341:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9544:Mllt3 UTSW 4 87841181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGTTTCAGAGGAATATAACC -3'
(R):5'- TCTTAACGTCTTAACTGTACAGGG -3'

Sequencing Primer
(F):5'- AATGTGCTGAGGATCATCCC -3'
(R):5'- ACAGGGTAATGATCGTTCTTAGCCAG -3'
Posted On 2019-09-13