Incidental Mutation 'R7380:Ankib1'
ID572623
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Nameankyrin repeat and IBR domain containing 1
Synonyms2310061P20Rik, 4631416I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7380 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location3690000-3802925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3722576 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 487 (Q487K)
Ref Sequence ENSEMBL: ENSMUSP00000040946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
Predicted Effect probably benign
Transcript: ENSMUST00000043551
AA Change: Q487K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: Q487K

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200335
AA Change: Q487K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: Q487K

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Naa15 T G 3: 51,459,847 probably null Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr396-ps1 T A 11: 73,928,187 Y61N possibly damaging Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTATAAACCCACCTCCGAGG -3'
(R):5'- TCACTGAGGTGCTTCTGTCC -3'

Sequencing Primer
(F):5'- TCCGAGGCCAGGGTGAAC -3'
(R):5'- TTTCCATCAGTAGTGCCCAAAG -3'
Posted On2019-09-13