Incidental Mutation 'R7380:Slc16a13'
ID572657
Institutional Source Beutler Lab
Gene Symbol Slc16a13
Ensembl Gene ENSMUSG00000044367
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 13
Synonyms1700007D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R7380 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70216789-70221064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70219279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 132 (Y132C)
Ref Sequence ENSEMBL: ENSMUSP00000053218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000326] [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably benign
Transcript: ENSMUST00000000326
SMART Domains Protein: ENSMUSP00000000326
Gene: ENSMUSG00000000317

DomainStartEndE-ValueType
BTB 38 135 2.17e-25 SMART
low complexity region 143 163 N/A INTRINSIC
ZnF_C2H2 323 345 4.11e-2 SMART
ZnF_C2H2 351 373 2.12e-4 SMART
ZnF_C2H2 379 401 8.34e-3 SMART
ZnF_C2H2 407 429 1.12e-3 SMART
ZnF_C2H2 435 458 1.33e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060010
AA Change: Y132C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367
AA Change: Y132C

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094055
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126296
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126388
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136328
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171032
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190533
AA Change: Y7C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Naa15 T G 3: 51,459,847 probably null Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr396-ps1 T A 11: 73,928,187 Y61N possibly damaging Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Slc16a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Slc16a13 APN 11 70220514 missense probably damaging 0.99
R0729:Slc16a13 UTSW 11 70219031 missense probably damaging 1.00
R0792:Slc16a13 UTSW 11 70220631 missense probably damaging 1.00
R1086:Slc16a13 UTSW 11 70219024 missense probably damaging 1.00
R1588:Slc16a13 UTSW 11 70218595 nonsense probably null
R1593:Slc16a13 UTSW 11 70219082 missense probably benign 0.04
R4329:Slc16a13 UTSW 11 70217897 missense probably benign 0.03
R4688:Slc16a13 UTSW 11 70220275 missense probably damaging 0.98
R6846:Slc16a13 UTSW 11 70217835 missense probably benign 0.35
R7390:Slc16a13 UTSW 11 70218971 missense probably benign 0.03
R7514:Slc16a13 UTSW 11 70218884 missense probably damaging 0.96
R7807:Slc16a13 UTSW 11 70220562 missense probably damaging 0.97
R7888:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
R7971:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTTCAGTCAGGGAGAGTGG -3'
(R):5'- AGATGGGGCTCTTATTCCAAAG -3'

Sequencing Primer
(F):5'- GGCGGAGGAGAGCACCAC -3'
(R):5'- ACCCCATTTTGCAGATGAGG -3'
Posted On2019-09-13