Incidental Mutation 'R0647:Fcho1'
ID 57268
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 038832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R0647 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71712560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 418 (A418T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,536,655 D184V possibly damaging Het
Adamts2 C A 11: 50,603,438 T113K probably damaging Het
Adgre1 T A 17: 57,411,003 N338K probably damaging Het
Aggf1 A T 13: 95,371,656 probably null Het
Apc2 A T 10: 80,304,928 I206F probably damaging Het
Carmil3 T C 14: 55,502,435 probably null Het
Ccdc110 A C 8: 45,943,388 E772A probably damaging Het
Cdh23 A G 10: 60,307,902 F2977L probably damaging Het
Cdh23 A T 10: 60,323,374 Y2207* probably null Het
Chd4 T A 6: 125,109,123 N908K probably damaging Het
Chst9 A G 18: 15,452,669 I279T probably damaging Het
Ctnna3 A T 10: 63,820,424 N261I probably benign Het
Dlgap2 A T 8: 14,727,591 S279C possibly damaging Het
Dock4 G A 12: 40,710,884 E524K probably damaging Het
Fabp12 T A 3: 10,246,036 N122I possibly damaging Het
Fam184b T C 5: 45,584,590 T100A probably benign Het
Fbxl5 T C 5: 43,768,069 D176G probably damaging Het
Foxe1 A G 4: 46,344,477 N95S possibly damaging Het
Frem3 A G 8: 80,615,185 E1369G probably damaging Het
Frmpd4 C T X: 167,489,010 E483K probably damaging Het
Gbp11 T C 5: 105,330,964 K203E possibly damaging Het
Gm10334 A T 6: 41,443,341 F150L probably benign Het
Hs3st6 C T 17: 24,758,160 R205C probably damaging Het
Ifitm10 C T 7: 142,356,035 S179N probably damaging Het
Irx2 A C 13: 72,630,680 N121T probably damaging Het
Itih1 A T 14: 30,935,863 V417E probably damaging Het
Itpr1 A C 6: 108,383,698 E695A probably damaging Het
Kif1c T A 11: 70,726,141 I755K probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Lrp1 G C 10: 127,571,477 T1865R probably damaging Het
Lrrc8b T A 5: 105,480,607 I273K possibly damaging Het
Ly9 T C 1: 171,599,808 Y393C probably damaging Het
Mphosph8 T C 14: 56,674,405 V295A probably benign Het
Nlrp5 T A 7: 23,417,707 D269E probably damaging Het
Olfr1294 A G 2: 111,537,359 V310A probably benign Het
Olfr398 G A 11: 73,983,771 A279V probably damaging Het
Olfr469 T A 7: 107,823,011 I153F probably benign Het
Olfr654 T G 7: 104,588,115 F104V probably damaging Het
Olfr720 T G 14: 14,175,858 T75P probably benign Het
Otud3 A G 4: 138,913,637 L64P probably damaging Het
Pcdh17 A T 14: 84,447,773 H560L possibly damaging Het
Pcdhb21 T C 18: 37,513,860 V14A probably damaging Het
Rbfox1 A T 16: 7,224,384 Q14L probably damaging Het
Rbm44 A G 1: 91,156,928 D665G probably benign Het
Rc3h2 C T 2: 37,409,530 V163M probably damaging Het
Sash1 T A 10: 8,729,552 R1025W probably damaging Het
Sgpl1 A G 10: 61,113,488 S146P probably damaging Het
Slc27a2 G A 2: 126,587,916 D615N probably benign Het
Smap1 A G 1: 23,853,478 I135T probably damaging Het
Snapc3 A G 4: 83,450,229 D321G probably damaging Het
St6galnac4 C T 2: 32,589,448 R6C probably damaging Het
Syne2 C T 12: 75,888,203 P153L probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Tmem94 A G 11: 115,796,795 N1160S probably damaging Het
Trim65 G A 11: 116,128,210 R168C possibly damaging Het
Txndc16 A T 14: 45,169,275 I241N probably damaging Het
Txndc16 T A 14: 45,165,361 R101* probably null Het
Ugt2b38 A G 5: 87,423,469 S235P probably benign Het
Ugt3a1 A T 15: 9,310,549 M306L probably benign Het
Vmn1r23 T A 6: 57,926,184 Y203F probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Wdfy4 A G 14: 33,109,699 C857R possibly damaging Het
Zfp493 A C 13: 67,783,875 K31T possibly damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGTTGTCACCGCCAATGTC -3'
(R):5'- GTCAAAATTCTGGATGCGCGGATG -3'

Sequencing Primer
(F):5'- ACCGCCAATGTCCGCAG -3'
(R):5'- GATGCGCGGATGAGTGG -3'
Posted On 2013-07-11