Incidental Mutation 'R7381:Rnpepl1'
ID572683
Institutional Source Beutler Lab
Gene Symbol Rnpepl1
Ensembl Gene ENSMUSG00000026269
Gene Namearginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7381 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location92910783-92924384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92919195 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 580 (S580G)
Ref Sequence ENSEMBL: ENSMUSP00000027487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027487] [ENSMUST00000178116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027487
AA Change: S580G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027487
Gene: ENSMUSG00000026269
AA Change: S580G

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Pfam:Peptidase_M1 36 440 3e-58 PFAM
Leuk-A4-hydro_C 523 668 1.31e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178116
SMART Domains Protein: ENSMUSP00000136080
Gene: ENSMUSG00000026269

DomainStartEndE-ValueType
Pfam:Peptidase_M1 5 170 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178816
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000179531
Predicted Effect probably benign
Transcript: ENSMUST00000179837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179854
Predicted Effect probably benign
Transcript: ENSMUST00000179993
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Rnpepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Rnpepl1 APN 1 92915899 missense possibly damaging 0.69
IGL01291:Rnpepl1 APN 1 92919746 missense probably benign
IGL02266:Rnpepl1 APN 1 92916889 missense probably damaging 1.00
IGL02481:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL02483:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL03377:Rnpepl1 APN 1 92919231 missense probably benign 0.01
ANU05:Rnpepl1 UTSW 1 92919746 missense probably benign
R0069:Rnpepl1 UTSW 1 92918898 missense possibly damaging 0.91
R0409:Rnpepl1 UTSW 1 92915860 missense probably damaging 1.00
R0479:Rnpepl1 UTSW 1 92918865 unclassified probably benign
R1155:Rnpepl1 UTSW 1 92916887 missense probably damaging 1.00
R1170:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R1397:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R1601:Rnpepl1 UTSW 1 92917222 missense possibly damaging 0.95
R2184:Rnpepl1 UTSW 1 92916823 missense probably benign 0.43
R2187:Rnpepl1 UTSW 1 92916895 missense probably null 1.00
R2211:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R2902:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3105:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3196:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R3439:Rnpepl1 UTSW 1 92916940 missense possibly damaging 0.94
R4887:Rnpepl1 UTSW 1 92915113 missense probably damaging 1.00
R4966:Rnpepl1 UTSW 1 92916761 missense probably damaging 1.00
R5212:Rnpepl1 UTSW 1 92911323 missense probably benign 0.03
R5214:Rnpepl1 UTSW 1 92919279 missense probably benign 0.01
R5385:Rnpepl1 UTSW 1 92917192 missense probably damaging 1.00
R5655:Rnpepl1 UTSW 1 92919310 missense probably damaging 1.00
R5694:Rnpepl1 UTSW 1 92918941 missense probably benign 0.03
R5940:Rnpepl1 UTSW 1 92917712 missense probably damaging 1.00
R6046:Rnpepl1 UTSW 1 92916821 missense probably damaging 1.00
R6086:Rnpepl1 UTSW 1 92917681 missense probably damaging 1.00
R6104:Rnpepl1 UTSW 1 92915884 missense probably benign
R6349:Rnpepl1 UTSW 1 92919841 missense probably damaging 1.00
R7402:Rnpepl1 UTSW 1 92919650 missense probably benign 0.01
R7474:Rnpepl1 UTSW 1 92918972 missense probably benign 0.14
R7714:Rnpepl1 UTSW 1 92917168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAGCCAGTGCCATTG -3'
(R):5'- TCTCAGAATTTGGGCTATAAGGGC -3'

Sequencing Primer
(F):5'- GTGCCATTGACATCTCCAAATGG -3'
(R):5'- CAAGGAGTGGGGATGCTGTC -3'
Posted On2019-09-13