Incidental Mutation 'R0647:Sash1'
ID57271
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
MMRRC Submission 038832-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0647 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8729552 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1025 (R1025W)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably damaging
Transcript: ENSMUST00000015449
AA Change: R1025W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: R1025W

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,536,655 D184V possibly damaging Het
Adamts2 C A 11: 50,603,438 T113K probably damaging Het
Adgre1 T A 17: 57,411,003 N338K probably damaging Het
Aggf1 A T 13: 95,371,656 probably null Het
Apc2 A T 10: 80,304,928 I206F probably damaging Het
Carmil3 T C 14: 55,502,435 probably null Het
Ccdc110 A C 8: 45,943,388 E772A probably damaging Het
Cdh23 A G 10: 60,307,902 F2977L probably damaging Het
Cdh23 A T 10: 60,323,374 Y2207* probably null Het
Chd4 T A 6: 125,109,123 N908K probably damaging Het
Chst9 A G 18: 15,452,669 I279T probably damaging Het
Ctnna3 A T 10: 63,820,424 N261I probably benign Het
Dlgap2 A T 8: 14,727,591 S279C possibly damaging Het
Dock4 G A 12: 40,710,884 E524K probably damaging Het
Fabp12 T A 3: 10,246,036 N122I possibly damaging Het
Fam184b T C 5: 45,584,590 T100A probably benign Het
Fbxl5 T C 5: 43,768,069 D176G probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Foxe1 A G 4: 46,344,477 N95S possibly damaging Het
Frem3 A G 8: 80,615,185 E1369G probably damaging Het
Frmpd4 C T X: 167,489,010 E483K probably damaging Het
Gbp11 T C 5: 105,330,964 K203E possibly damaging Het
Gm10334 A T 6: 41,443,341 F150L probably benign Het
Hs3st6 C T 17: 24,758,160 R205C probably damaging Het
Ifitm10 C T 7: 142,356,035 S179N probably damaging Het
Irx2 A C 13: 72,630,680 N121T probably damaging Het
Itih1 A T 14: 30,935,863 V417E probably damaging Het
Itpr1 A C 6: 108,383,698 E695A probably damaging Het
Kif1c T A 11: 70,726,141 I755K probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Lrp1 G C 10: 127,571,477 T1865R probably damaging Het
Lrrc8b T A 5: 105,480,607 I273K possibly damaging Het
Ly9 T C 1: 171,599,808 Y393C probably damaging Het
Mphosph8 T C 14: 56,674,405 V295A probably benign Het
Nlrp5 T A 7: 23,417,707 D269E probably damaging Het
Olfr1294 A G 2: 111,537,359 V310A probably benign Het
Olfr398 G A 11: 73,983,771 A279V probably damaging Het
Olfr469 T A 7: 107,823,011 I153F probably benign Het
Olfr654 T G 7: 104,588,115 F104V probably damaging Het
Olfr720 T G 14: 14,175,858 T75P probably benign Het
Otud3 A G 4: 138,913,637 L64P probably damaging Het
Pcdh17 A T 14: 84,447,773 H560L possibly damaging Het
Pcdhb21 T C 18: 37,513,860 V14A probably damaging Het
Rbfox1 A T 16: 7,224,384 Q14L probably damaging Het
Rbm44 A G 1: 91,156,928 D665G probably benign Het
Rc3h2 C T 2: 37,409,530 V163M probably damaging Het
Sgpl1 A G 10: 61,113,488 S146P probably damaging Het
Slc27a2 G A 2: 126,587,916 D615N probably benign Het
Smap1 A G 1: 23,853,478 I135T probably damaging Het
Snapc3 A G 4: 83,450,229 D321G probably damaging Het
St6galnac4 C T 2: 32,589,448 R6C probably damaging Het
Syne2 C T 12: 75,888,203 P153L probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Tmem94 A G 11: 115,796,795 N1160S probably damaging Het
Trim65 G A 11: 116,128,210 R168C possibly damaging Het
Txndc16 A T 14: 45,169,275 I241N probably damaging Het
Txndc16 T A 14: 45,165,361 R101* probably null Het
Ugt2b38 A G 5: 87,423,469 S235P probably benign Het
Ugt3a1 A T 15: 9,310,549 M306L probably benign Het
Vmn1r23 T A 6: 57,926,184 Y203F probably benign Het
Vmn2r3 T A 3: 64,275,625 I218F probably damaging Het
Wdfy4 A G 14: 33,109,699 C857R possibly damaging Het
Zfp493 A C 13: 67,783,875 K31T possibly damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0830:Sash1 UTSW 10 8729909 missense probably benign 0.01
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
R7752:Sash1 UTSW 10 8780564 nonsense probably null
R7856:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7901:Sash1 UTSW 10 8780564 nonsense probably null
R7939:Sash1 UTSW 10 8729708 missense probably benign 0.00
R7984:Sash1 UTSW 10 8780564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTCAGTGAGATCAATGCCCTCC -3'
(R):5'- CGCCTGTTAAACCCGGCTTAACAAG -3'

Sequencing Primer
(F):5'- TGCAGCTTGTTCTCCGTGAG -3'
(R):5'- GTCTCAGAAAAGGACATGATCAC -3'
Posted On2013-07-11