Incidental Mutation 'R7381:Mios'
ID572712
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Namemeiosis regulator for oocyte development
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7381 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location8209222-8236274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8216064 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 420 (D420G)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
Predicted Effect probably damaging
Transcript: ENSMUST00000040017
AA Change: D420G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: D420G

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Meta Mutation Damage Score 0.4055 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Abca8a A T 11: 110,030,087 probably null Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Chpt1 G A 10: 88,475,331 probably null Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Eps8l1 T A 7: 4,470,438 probably null Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fbxo34 C G 14: 47,530,535 R502G probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Gm10722 C A 9: 3,001,235 L104I probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptar1 A T 19: 23,708,970 probably null Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Sis A T 3: 72,913,292 probably null Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1802:Mios UTSW 6 8216385 nonsense probably null
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R5714:Mios UTSW 6 8215434 missense probably damaging 0.99
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6111:Mios UTSW 6 8214836 missense probably benign 0.01
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCCTGGAGCCCAATTACATC -3'
(R):5'- CCAATGATCCTTTGTTGCCTGG -3'

Sequencing Primer
(F):5'- CCTGGAGCCCAATTACATCTTTAATG -3'
(R):5'- TGCCTGGAGATTTTTGATCATTATC -3'
Posted On2019-09-13