Incidental Mutation 'R7381:Ptpro'
ID572717
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7381 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137399561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 680 (V680I)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077115
AA Change: V680I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V680I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167679
AA Change: V680I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V680I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Abca8a A T 11: 110,030,087 probably null Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Chpt1 G A 10: 88,475,331 probably null Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Eps8l1 T A 7: 4,470,438 probably null Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fbxo34 C G 14: 47,530,535 R502G probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Gm10722 C A 9: 3,001,235 L104I probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptar1 A T 19: 23,708,970 probably null Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Sis A T 3: 72,913,292 probably null Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
Brau UTSW 6 137454598 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
Hoff UTSW 6 137443594 missense probably damaging 1.00
Jester UTSW 6 137449917 missense probably damaging 1.00
mann UTSW 6 137411116 splice site probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1448:Ptpro UTSW 6 137441116 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
R7019:Ptpro UTSW 6 137380478 missense probably benign
R7218:Ptpro UTSW 6 137454598 missense probably damaging 1.00
R7236:Ptpro UTSW 6 137368337 missense probably damaging 1.00
R7299:Ptpro UTSW 6 137441144 critical splice donor site probably null
R7493:Ptpro UTSW 6 137382649 missense probably benign 0.01
R7733:Ptpro UTSW 6 137414286 nonsense probably null
R7793:Ptpro UTSW 6 137416820 missense probably damaging 0.99
R7804:Ptpro UTSW 6 137399601 splice site probably null
R7833:Ptpro UTSW 6 137416863 nonsense probably null
R7859:Ptpro UTSW 6 137392807 critical splice donor site probably null
R7873:Ptpro UTSW 6 137430739 missense probably benign 0.44
R8042:Ptpro UTSW 6 137416883 missense possibly damaging 0.71
Z1177:Ptpro UTSW 6 137378140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCGGCTCTCACACTTGG -3'
(R):5'- AGCTTGTTTGATAGCACACAGC -3'

Sequencing Primer
(F):5'- TCTCACACTTGGCTGGGGAG -3'
(R):5'- AAAGCTCTCATGTGTCCTAGG -3'
Posted On2019-09-13