Incidental Mutation 'R7381:Rnf170'
ID572731
Institutional Source Beutler Lab
Gene Symbol Rnf170
Ensembl Gene ENSMUSG00000013878
Gene Namering finger protein 170
Synonyms6720407G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7381 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location26119368-26151790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26123848 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 28 (P28S)
Ref Sequence ENSEMBL: ENSMUSP00000014022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014022] [ENSMUST00000037182] [ENSMUST00000110575] [ENSMUST00000110579] [ENSMUST00000124757] [ENSMUST00000131138] [ENSMUST00000140819] [ENSMUST00000153528] [ENSMUST00000209300] [ENSMUST00000209707]
Predicted Effect probably benign
Transcript: ENSMUST00000014022
AA Change: P28S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000014022
Gene: ENSMUSG00000013878
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 157 1.06e-8 SMART
Pfam:DUF1232 230 267 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037182
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110575
AA Change: P28S

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106204
Gene: ENSMUSG00000013878
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 163 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110579
AA Change: P28S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106208
Gene: ENSMUSG00000013878
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 138 6.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124757
AA Change: P28S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115588
Gene: ENSMUSG00000013878
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 136 6e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124867
SMART Domains Protein: ENSMUSP00000115959
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
SCOP:d1fbva4 49 99 9e-7 SMART
Blast:RING 79 100 2e-9 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140819
AA Change: P28S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119906
Gene: ENSMUSG00000013878
AA Change: P28S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153528
SMART Domains Protein: ENSMUSP00000118689
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
RING 68 110 1.06e-8 SMART
Pfam:DUF1232 181 221 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209300
AA Change: P28S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209707
AA Change: P28S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null allele develop progressive gait abnormalities that are more pronounced in dark conditions with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Abca8a A T 11: 110,030,087 probably null Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Chpt1 G A 10: 88,475,331 probably null Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Eps8l1 T A 7: 4,470,438 probably null Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fbxo34 C G 14: 47,530,535 R502G probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Gm10722 C A 9: 3,001,235 L104I probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptar1 A T 19: 23,708,970 probably null Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Sis A T 3: 72,913,292 probably null Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Rnf170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Rnf170 APN 8 26125918 missense probably damaging 1.00
IGL02100:Rnf170 APN 8 26123984 missense probably damaging 1.00
R0382:Rnf170 UTSW 8 26125899 splice site probably benign
R1537:Rnf170 UTSW 8 26139048 missense probably benign 0.06
R1663:Rnf170 UTSW 8 26129143 missense probably damaging 1.00
R4788:Rnf170 UTSW 8 26140863 missense probably damaging 0.98
R4940:Rnf170 UTSW 8 26125911 nonsense probably null
R5174:Rnf170 UTSW 8 26129168 missense probably benign 0.22
R5511:Rnf170 UTSW 8 26140999 missense probably damaging 1.00
R6115:Rnf170 UTSW 8 26125966 missense possibly damaging 0.57
R6291:Rnf170 UTSW 8 26140964 missense probably damaging 1.00
R8138:Rnf170 UTSW 8 26125981 critical splice donor site probably null
R8744:Rnf170 UTSW 8 26129380 missense unknown
R8818:Rnf170 UTSW 8 26139015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGGTAGGGGAATAGTCTTTCC -3'
(R):5'- GCCATCGGCCTTTAGAACTAC -3'

Sequencing Primer
(F):5'- GCGACCCCAGAACTTTGTATATGG -3'
(R):5'- CGGCCTTTAGAACTACTCAGTATTTG -3'
Posted On2019-09-13