Incidental Mutation 'R7381:Piezo1'
ID572734
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7381 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122501658 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 297 (F297L)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000156333]
Predicted Effect probably benign
Transcript: ENSMUST00000067252
AA Change: F296L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: F296L

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: F297L

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Abca8a A T 11: 110,030,087 probably null Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Chpt1 G A 10: 88,475,331 probably null Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Eps8l1 T A 7: 4,470,438 probably null Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fbxo34 C G 14: 47,530,535 R502G probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Gm10722 C A 9: 3,001,235 L104I probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptar1 A T 19: 23,708,970 probably null Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Sis A T 3: 72,913,292 probably null Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 splice site probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 splice site probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense
R7337:Piezo1 UTSW 8 122485724 missense
R7480:Piezo1 UTSW 8 122498495 nonsense probably null
R7515:Piezo1 UTSW 8 122485296 missense
R7571:Piezo1 UTSW 8 122498418 missense
R7601:Piezo1 UTSW 8 122483481 splice site probably null
R7827:Piezo1 UTSW 8 122482920 missense probably damaging 0.96
R7923:Piezo1 UTSW 8 122496444 missense
R7975:Piezo1 UTSW 8 122495765 missense
R8071:Piezo1 UTSW 8 122487011 missense probably null
R8231:Piezo1 UTSW 8 122506097 missense
R8270:Piezo1 UTSW 8 122501559 missense
Predicted Primers PCR Primer
(F):5'- GACGCCAACAGAGTTGACAG -3'
(R):5'- ACCCTCTGTGTCATGGTGAG -3'

Sequencing Primer
(F):5'- TTGACAGCAGGGACTCACCAG -3'
(R):5'- GGTGCCGGCCATCTCATTTG -3'
Posted On2019-09-13