Incidental Mutation 'R7381:Ptprb'
ID572744
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7381 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116341133 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 988 (I988V)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: I988V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: I988V

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: I1275V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Abca8a A T 11: 110,030,087 probably null Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Chpt1 G A 10: 88,475,331 probably null Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Eps8l1 T A 7: 4,470,438 probably null Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Fbxo34 C G 14: 47,530,535 R502G probably benign Het
Fxr2 G A 11: 69,642,049 C151Y possibly damaging Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Gm10722 C A 9: 3,001,235 L104I probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptar1 A T 19: 23,708,970 probably null Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Sis A T 3: 72,913,292 probably null Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7833:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7834:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R7916:Ptprb UTSW 10 116315251 missense probably benign 0.01
R7917:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7929:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7979:Ptprb UTSW 10 116369457 splice site probably null
R7984:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7993:Ptprb UTSW 10 116322487 missense probably damaging 1.00
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGATAGGCTGATGGTAACCTG -3'
(R):5'- TTAGGGCAAAGTCCTCCACTG -3'

Sequencing Primer
(F):5'- TGATGGTAACCTGGAGCCCTG -3'
(R):5'- GGAAAGACTCTCTAAAATCCTAGTGC -3'
Posted On2019-09-13