Mutagenetix > Incidental Mutation

Incidental Mutation 'R7381:Sdk2'

572750

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

045463-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 113838489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1087 (S1087R)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably damaging
Transcript: ENSMUST00000041627
AA Change: S1087R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: S1087R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	T	11: 76,003,007	D70V	probably damaging	Het
4930550C14Rik	T	C	9: 53,411,822	Y53H	probably damaging	Het
Abca8a	A	T	11: 110,030,087		probably null	Het
Acads	C	A	5: 115,110,998	Q365H	probably damaging	Het
Acsm3	A	G	7: 119,780,826	D462G	probably damaging	Het
Adam39	T	A	8: 40,825,963	C464S	probably damaging	Het
Adgra3	A	G	5: 50,058,774	M1T	probably null	Het
AI182371	T	C	2: 35,085,359	Y276C	probably damaging	Het
Ank2	T	A	3: 126,936,628	H719L	possibly damaging	Het
Ano7	G	A	1: 93,395,335	V466I	probably benign	Het
Art5	A	G	7: 102,098,170	L134P	probably damaging	Het
Atcay	A	G	10: 81,210,597	Y298H	possibly damaging	Het
Atp1a4	A	T	1: 172,240,115	F527Y	possibly damaging	Het
Bpifb2	A	T	2: 153,892,348	M428L	probably benign	Het
Brinp2	A	C	1: 158,246,343	V736G	probably benign	Het
Cdc5l	C	T	17: 45,411,923	A437T	probably benign	Het
Cdx2	G	A	5: 147,306,630	P118L	possibly damaging	Het
Chpt1	G	A	10: 88,475,331		probably null	Het
Creb3l2	T	A	6: 37,335,848	E417V	probably damaging	Het
Csnk2a1	A	G	2: 152,258,694	T129A	probably benign	Het
Dennd6b	A	T	15: 89,186,173	L431Q	possibly damaging	Het
Dgkz	C	T	2: 91,944,835	A260T	probably benign	Het
Dhx34	T	A	7: 16,215,448	T352S	probably benign	Het
Elp4	C	T	2: 105,792,307	R349Q	not run	Het
Emsy	A	C	7: 98,590,803	F1228V	probably damaging	Het
Eps8l1	T	A	7: 4,470,438		probably null	Het
Faf1	T	A	4: 109,861,937	D413E	probably damaging	Het
Fam71e2	C	A	7: 4,757,682	R677L		Het
Fat3	T	C	9: 16,246,987	Y1109C	probably damaging	Het
Fbp1	T	C	13: 62,865,053	K314E	probably benign	Het
Fbxl20	A	G	11: 98,090,788	V358A	probably benign	Het
Fbxo34	C	G	14: 47,530,535	R502G	probably benign	Het
Fxr2	G	A	11: 69,642,049	C151Y	possibly damaging	Het
Gja8	T	C	3: 96,920,022	D108G	probably benign	Het
Gm10722	C	A	9: 3,001,235	L104I	probably benign	Het
Grsf1	A	G	5: 88,665,807	V361A	probably benign	Het
Gsap	T	A	5: 21,226,787	I228N	probably damaging	Het
Hagh	T	C	17: 24,856,712	I131T	probably damaging	Het
Heca	A	T	10: 17,915,524	Y261*	probably null	Het
Hipk3	A	G	2: 104,439,351	F498L	probably damaging	Het
Hps4	T	A	5: 112,375,458	I614N	possibly damaging	Het
Icam1	T	C	9: 21,027,590	S450P	probably benign	Het
Il22	G	A	10: 118,205,164	M58I	possibly damaging	Het
Khdrbs2	T	A	1: 32,333,802	S186T	not run	Het
Kif16b	A	G	2: 142,857,423	F79S	probably damaging	Het
Kntc1	C	A	5: 123,810,908	F1905L	probably benign	Het
Lrp1b	C	T	2: 40,802,917	G3423D		Het
Lrp5	G	T	19: 3,593,588	Q1346K	probably benign	Het
Map3k21	A	C	8: 125,944,978	T1002P	possibly damaging	Het
Mdga2	G	T	12: 66,568,896	R646S	probably benign	Het
Mex3b	G	T	7: 82,868,865	M129I	possibly damaging	Het
Mfsd10	G	T	5: 34,636,426	N85K	probably damaging	Het
Mios	A	G	6: 8,216,064	D420G	probably damaging	Het
Mogs	C	A	6: 83,115,632	P18T	unknown	Het
Mrgpre	A	G	7: 143,781,413	C118R	probably damaging	Het
Muc4	A	T	16: 32,780,915	H1321L		Het
Nkapl	T	C	13: 21,467,589	K285E	probably damaging	Het
Nphp4	C	T	4: 152,499,003	P200S	possibly damaging	Het
Piezo1	A	G	8: 122,501,658	F297L		Het
Pkhd1	T	G	1: 20,200,973	S3119R	probably damaging	Het
Pla2g15	G	A	8: 106,162,944	V283I	probably benign	Het
Ppp1r13l	T	A	7: 19,368,861		probably null	Het
Prex1	A	G	2: 166,587,127	Y849H	probably damaging	Het
Psg27	C	A	7: 18,567,083	W15L	probably benign	Het
Ptar1	A	T	19: 23,708,970		probably null	Het
Ptpn6	G	A	6: 124,728,172	R264C	probably damaging	Het
Ptprb	A	G	10: 116,341,133	I988V	probably benign	Het
Ptpro	G	A	6: 137,399,561	V680I	possibly damaging	Het
Rnf170	C	T	8: 26,123,848	P28S	probably benign	Het
Rnpepl1	A	G	1: 92,919,195	S580G	possibly damaging	Het
Rtel1	C	T	2: 181,330,815	R29*	probably null	Het
Rtkn	T	C	6: 83,151,745	L26P	probably damaging	Het
Sema7a	C	T	9: 57,953,569	P71L	probably benign	Het
Sgpp1	C	T	12: 75,716,264	C381Y	probably damaging	Het
Sis	A	T	3: 72,913,292		probably null	Het
Slc24a5	A	C	2: 125,068,949	D100A	probably benign	Het
Slc25a23	A	T	17: 57,053,587	I251K	probably damaging	Het
Slc6a5	T	A	7: 49,930,056	L394H	probably damaging	Het
Slc7a4	A	T	16: 17,575,056	M293K	probably damaging	Het
Syne2	T	A	12: 75,926,489	S1089T	probably benign	Het
Tanc1	A	T	2: 59,785,326	T226S	probably damaging	Het
Tdrd6	T	C	17: 43,626,093	T1355A	probably benign	Het
Tmem101	A	G	11: 102,153,350	M237T	possibly damaging	Het
Ttn	G	A	2: 76,919,015	H3897Y	possibly damaging	Het
Tubb4a	C	T	17: 57,080,698	V443M	unknown	Het
Ucp2	G	A	7: 100,498,369	R185H	possibly damaging	Het
Vmn1r116	G	T	7: 20,872,511	E86*	probably null	Het
Vmn2r37	T	C	7: 9,210,033	E530G	probably benign	Het
Vwa8	A	G	14: 79,095,685	T1293A	probably benign	Het
Zfc3h1	T	A	10: 115,424,630	Y1711N	probably benign	Het
Zfp873	A	T	10: 82,060,971	E512V	probably damaging	Het
Zfyve16	T	A	13: 92,521,146	K752N	probably damaging	Het
Zhx1	T	C	15: 58,053,165	N562D	possibly damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCACAGGTAAAGAATTGTCG -3'
(R):5'- CTACCAACTCGGCAATGAGC -3'

Sequencing Primer
(F):5'- CGATATTTGACTAGTGACCTTTGAG -3'
(R):5'- ATGAGCCTGACGCCCGTTC -3'

Posted On

2019-09-13