Incidental Mutation 'R7382:Stxbp1'
ID572771
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Namesyntaxin binding protein 1
SynonymsRb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R7382 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32787602-32847245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32798168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 495 (D495G)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458]
Predicted Effect probably damaging
Transcript: ENSMUST00000050000
AA Change: D495G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: D495G

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077458
AA Change: D495G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: D495G

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,067,269 H404Q probably damaging Het
Adam8 T A 7: 139,990,107 T82S possibly damaging Het
Adgrl2 T G 3: 148,817,283 Q435P Het
Ahr A T 12: 35,504,515 M535K probably damaging Het
Akap6 A G 12: 53,142,171 I2123V probably benign Het
Ankrd2 G T 19: 42,044,972 G318C Het
Ap4e1 T A 2: 127,008,902 probably null Het
Atp8a2 G A 14: 59,654,594 P1102S probably benign Het
Cacna2d4 C T 6: 119,239,087 S105F probably damaging Het
Cad C A 5: 31,075,829 P1872T probably benign Het
Catsperg1 A G 7: 29,204,844 F251L probably benign Het
Ccdc129 G T 6: 55,978,419 G1004V probably benign Het
Ccdc18 C A 5: 108,139,007 Q136K probably damaging Het
Cd163 A G 6: 124,311,312 probably null Het
Cd209d A T 8: 3,877,965 Y46* probably null Het
Cdk5rap2 A T 4: 70,290,025 M728K probably benign Het
Cdon A G 9: 35,478,648 D866G probably damaging Het
Cenpl A G 1: 161,078,461 H135R probably benign Het
Clstn2 A T 9: 97,799,398 L63* probably null Het
Cpeb4 A G 11: 31,872,828 T181A probably damaging Het
Dlgap1 A G 17: 70,787,174 E830G probably damaging Het
Endou T A 15: 97,718,926 K239* probably null Het
Ezh2 T C 6: 47,551,836 N263S possibly damaging Het
Fbxw2 T C 2: 34,807,302 D351G probably benign Het
Fer1l4 A T 2: 156,020,749 Y1720* probably null Het
Fmo9 A T 1: 166,663,660 probably null Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Frmpd1 T A 4: 45,278,880 V535E probably benign Het
Fxr2 T C 11: 69,641,556 V139A probably benign Het
Gm5538 T A 3: 59,743,616 M53K probably benign Het
Gpr180 T G 14: 118,162,623 V401G possibly damaging Het
Heatr5b G T 17: 78,803,507 R971S possibly damaging Het
Igkv8-34 C A 6: 70,044,119 A120S probably benign Het
Inpp5b T A 4: 124,751,577 H219Q probably benign Het
Kremen2 T C 17: 23,743,552 probably null Het
Mael G A 1: 166,201,598 P419S probably benign Het
Map1a A G 2: 121,290,785 T102A probably damaging Het
Mfsd2a A T 4: 122,952,123 I119N possibly damaging Het
Muc5b T C 7: 141,858,948 V1877A unknown Het
Myo5c A C 9: 75,304,050 S1733R probably damaging Het
Nelfcd T C 2: 174,423,383 V248A probably benign Het
Npc1 A T 18: 12,201,706 I663N probably damaging Het
Olfr1089 T C 2: 86,732,785 I276V probably benign Het
Olfr346 G T 2: 36,688,034 E11* probably null Het
Olig3 T A 10: 19,356,665 S13T unknown Het
Piezo2 A C 18: 63,017,519 probably null Het
Pkd1l2 G T 8: 117,054,871 L812M possibly damaging Het
Plcd1 G A 9: 119,074,691 T387I probably damaging Het
Ppara C T 15: 85,787,228 S110L probably damaging Het
Ranbp9 C T 13: 43,425,114 R161Q probably damaging Het
Rufy2 G T 10: 62,997,969 R270L probably benign Het
Sept12 C T 16: 4,988,482 E272K probably damaging Het
Sgms1 T C 19: 32,159,782 E128G possibly damaging Het
Sh3bgr G A 16: 96,205,893 S21N probably benign Het
Sil1 A T 18: 35,325,413 D176E probably benign Het
Slc13a2 A T 11: 78,404,795 Y82N probably damaging Het
Slc41a1 C T 1: 131,846,632 P479L probably damaging Het
Smarca4 A G 9: 21,658,933 K744R probably damaging Het
Sugp2 T C 8: 70,242,844 S156P probably benign Het
Syt3 A T 7: 44,392,746 D343V probably damaging Het
Tbl3 G T 17: 24,705,291 T164N probably benign Het
Tbpl2 A T 2: 24,087,314 probably null Het
Tcf7l2 T A 19: 55,926,740 W461R unknown Het
Tmprss11c A T 5: 86,231,864 F395Y probably benign Het
Tnc A T 4: 64,014,043 Y711* probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc41 A G 10: 86,776,510 K1216E probably damaging Het
Ube2q2 A C 9: 55,163,014 D80A probably damaging Het
Ube2u A T 4: 100,532,182 K227* probably null Het
Uhrf2 T C 19: 30,071,388 Y265H possibly damaging Het
Vmn1r208 T G 13: 22,772,586 Y247S probably damaging Het
Vmn2r27 A G 6: 124,197,317 C525R probably damaging Het
Vps13a T C 19: 16,619,485 T3090A probably damaging Het
Whrn T C 4: 63,418,336 K674R probably benign Het
Zfp202 G T 9: 40,211,505 R521I probably damaging Het
Zfp433 T C 10: 81,720,825 V387A probably benign Het
Zpld1 T C 16: 55,246,683 probably null Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32812064 missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32819901 missense probably damaging 0.98
volume UTSW 2 32801893 missense probably damaging 0.99
volume2 UTSW 2 32801883 missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32823538 missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32801870 missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32823542 missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32802905 splice site probably benign
R0565:Stxbp1 UTSW 2 32819848 missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32800695 splice site probably benign
R1022:Stxbp1 UTSW 2 32814967 unclassified probably null
R1024:Stxbp1 UTSW 2 32814967 unclassified probably null
R1295:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32800617 missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32806719 critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32798189 missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32794674 missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32796018 missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32794609 missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32801883 missense possibly damaging 0.95
R6770:Stxbp1 UTSW 2 32819889 missense probably benign 0.01
R6954:Stxbp1 UTSW 2 32801893 missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32815014 missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32818505 missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32801820 missense probably benign 0.00
RF010:Stxbp1 UTSW 2 32821915 missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32802768 missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32802754 missense probably null 1.00
Z1177:Stxbp1 UTSW 2 32809128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGCCATAATGGATGACGTGG -3'
(R):5'- TCTGACAGAGTGACTCATGGGC -3'

Sequencing Primer
(F):5'- CGTGGGAAGGTTCAAATGGCAC -3'
(R):5'- CTGCTACAGAAGGAGTGTCC -3'
Posted On2019-09-13