Incidental Mutation 'R7382:Nelfcd'
ID572778
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7382 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174423383 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 248 (V248A)
Ref Sequence ENSEMBL: ENSMUSP00000016397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably benign
Transcript: ENSMUST00000016397
AA Change: V248A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: V248A

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109075
AA Change: V232A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: V232A

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,067,269 H404Q probably damaging Het
Adam8 T A 7: 139,990,107 T82S possibly damaging Het
Adgrl2 T G 3: 148,817,283 Q435P Het
Ahr A T 12: 35,504,515 M535K probably damaging Het
Akap6 A G 12: 53,142,171 I2123V probably benign Het
Ankrd2 G T 19: 42,044,972 G318C Het
Ap4e1 T A 2: 127,008,902 probably null Het
Atp8a2 G A 14: 59,654,594 P1102S probably benign Het
Cacna2d4 C T 6: 119,239,087 S105F probably damaging Het
Cad C A 5: 31,075,829 P1872T probably benign Het
Catsperg1 A G 7: 29,204,844 F251L probably benign Het
Ccdc129 G T 6: 55,978,419 G1004V probably benign Het
Ccdc18 C A 5: 108,139,007 Q136K probably damaging Het
Cd163 A G 6: 124,311,312 probably null Het
Cd209d A T 8: 3,877,965 Y46* probably null Het
Cdk5rap2 A T 4: 70,290,025 M728K probably benign Het
Cdon A G 9: 35,478,648 D866G probably damaging Het
Cenpl A G 1: 161,078,461 H135R probably benign Het
Clstn2 A T 9: 97,799,398 L63* probably null Het
Cpeb4 A G 11: 31,872,828 T181A probably damaging Het
Dlgap1 A G 17: 70,787,174 E830G probably damaging Het
Endou T A 15: 97,718,926 K239* probably null Het
Ezh2 T C 6: 47,551,836 N263S possibly damaging Het
Fbxw2 T C 2: 34,807,302 D351G probably benign Het
Fer1l4 A T 2: 156,020,749 Y1720* probably null Het
Fmo9 A T 1: 166,663,660 probably null Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Frmpd1 T A 4: 45,278,880 V535E probably benign Het
Fxr2 T C 11: 69,641,556 V139A probably benign Het
Gm5538 T A 3: 59,743,616 M53K probably benign Het
Gpr180 T G 14: 118,162,623 V401G possibly damaging Het
Heatr5b G T 17: 78,803,507 R971S possibly damaging Het
Igkv8-34 C A 6: 70,044,119 A120S probably benign Het
Inpp5b T A 4: 124,751,577 H219Q probably benign Het
Kremen2 T C 17: 23,743,552 probably null Het
Mael G A 1: 166,201,598 P419S probably benign Het
Map1a A G 2: 121,290,785 T102A probably damaging Het
Mfsd2a A T 4: 122,952,123 I119N possibly damaging Het
Muc5b T C 7: 141,858,948 V1877A unknown Het
Myo5c A C 9: 75,304,050 S1733R probably damaging Het
Npc1 A T 18: 12,201,706 I663N probably damaging Het
Olfr1089 T C 2: 86,732,785 I276V probably benign Het
Olfr346 G T 2: 36,688,034 E11* probably null Het
Olig3 T A 10: 19,356,665 S13T unknown Het
Piezo2 A C 18: 63,017,519 probably null Het
Pkd1l2 G T 8: 117,054,871 L812M possibly damaging Het
Plcd1 G A 9: 119,074,691 T387I probably damaging Het
Ppara C T 15: 85,787,228 S110L probably damaging Het
Ranbp9 C T 13: 43,425,114 R161Q probably damaging Het
Rufy2 G T 10: 62,997,969 R270L probably benign Het
Sept12 C T 16: 4,988,482 E272K probably damaging Het
Sgms1 T C 19: 32,159,782 E128G possibly damaging Het
Sh3bgr G A 16: 96,205,893 S21N probably benign Het
Sil1 A T 18: 35,325,413 D176E probably benign Het
Slc13a2 A T 11: 78,404,795 Y82N probably damaging Het
Slc41a1 C T 1: 131,846,632 P479L probably damaging Het
Smarca4 A G 9: 21,658,933 K744R probably damaging Het
Stxbp1 T C 2: 32,798,168 D495G probably damaging Het
Sugp2 T C 8: 70,242,844 S156P probably benign Het
Syt3 A T 7: 44,392,746 D343V probably damaging Het
Tbl3 G T 17: 24,705,291 T164N probably benign Het
Tbpl2 A T 2: 24,087,314 probably null Het
Tcf7l2 T A 19: 55,926,740 W461R unknown Het
Tmprss11c A T 5: 86,231,864 F395Y probably benign Het
Tnc A T 4: 64,014,043 Y711* probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc41 A G 10: 86,776,510 K1216E probably damaging Het
Ube2q2 A C 9: 55,163,014 D80A probably damaging Het
Ube2u A T 4: 100,532,182 K227* probably null Het
Uhrf2 T C 19: 30,071,388 Y265H possibly damaging Het
Vmn1r208 T G 13: 22,772,586 Y247S probably damaging Het
Vmn2r27 A G 6: 124,197,317 C525R probably damaging Het
Vps13a T C 19: 16,619,485 T3090A probably damaging Het
Whrn T C 4: 63,418,336 K674R probably benign Het
Zfp202 G T 9: 40,211,505 R521I probably damaging Het
Zfp433 T C 10: 81,720,825 V387A probably benign Het
Zpld1 T C 16: 55,246,683 probably null Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
R7532:Nelfcd UTSW 2 174426396 missense probably damaging 1.00
R7545:Nelfcd UTSW 2 174423978 splice site probably null
R7766:Nelfcd UTSW 2 174426832 missense possibly damaging 0.87
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTCTGAATCTCAGGCTACATGG -3'
(R):5'- TGAGTTCAGCTCCACAGGTAAG -3'

Sequencing Primer
(F):5'- TCTCAGGCTACATGGAGACG -3'
(R):5'- TTCAGCTCCACAGGTAAGTAAAG -3'
Posted On2019-09-13