Incidental Mutation 'R7382:Cdk5rap2'
ID572784
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R7382 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70290025 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 728 (M728K)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: M728K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: M728K

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,067,269 H404Q probably damaging Het
Adam8 T A 7: 139,990,107 T82S possibly damaging Het
Adgrl2 T G 3: 148,817,283 Q435P Het
Ahr A T 12: 35,504,515 M535K probably damaging Het
Akap6 A G 12: 53,142,171 I2123V probably benign Het
Ankrd2 G T 19: 42,044,972 G318C Het
Ap4e1 T A 2: 127,008,902 probably null Het
Atp8a2 G A 14: 59,654,594 P1102S probably benign Het
Cacna2d4 C T 6: 119,239,087 S105F probably damaging Het
Cad C A 5: 31,075,829 P1872T probably benign Het
Catsperg1 A G 7: 29,204,844 F251L probably benign Het
Ccdc129 G T 6: 55,978,419 G1004V probably benign Het
Ccdc18 C A 5: 108,139,007 Q136K probably damaging Het
Cd163 A G 6: 124,311,312 probably null Het
Cd209d A T 8: 3,877,965 Y46* probably null Het
Cdon A G 9: 35,478,648 D866G probably damaging Het
Cenpl A G 1: 161,078,461 H135R probably benign Het
Clstn2 A T 9: 97,799,398 L63* probably null Het
Cpeb4 A G 11: 31,872,828 T181A probably damaging Het
Dlgap1 A G 17: 70,787,174 E830G probably damaging Het
Endou T A 15: 97,718,926 K239* probably null Het
Ezh2 T C 6: 47,551,836 N263S possibly damaging Het
Fbxw2 T C 2: 34,807,302 D351G probably benign Het
Fer1l4 A T 2: 156,020,749 Y1720* probably null Het
Fmo9 A T 1: 166,663,660 probably null Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Frmpd1 T A 4: 45,278,880 V535E probably benign Het
Fxr2 T C 11: 69,641,556 V139A probably benign Het
Gm5538 T A 3: 59,743,616 M53K probably benign Het
Gpr180 T G 14: 118,162,623 V401G possibly damaging Het
Heatr5b G T 17: 78,803,507 R971S possibly damaging Het
Igkv8-34 C A 6: 70,044,119 A120S probably benign Het
Inpp5b T A 4: 124,751,577 H219Q probably benign Het
Kremen2 T C 17: 23,743,552 probably null Het
Mael G A 1: 166,201,598 P419S probably benign Het
Map1a A G 2: 121,290,785 T102A probably damaging Het
Mfsd2a A T 4: 122,952,123 I119N possibly damaging Het
Muc5b T C 7: 141,858,948 V1877A unknown Het
Myo5c A C 9: 75,304,050 S1733R probably damaging Het
Nelfcd T C 2: 174,423,383 V248A probably benign Het
Npc1 A T 18: 12,201,706 I663N probably damaging Het
Olfr1089 T C 2: 86,732,785 I276V probably benign Het
Olfr346 G T 2: 36,688,034 E11* probably null Het
Olig3 T A 10: 19,356,665 S13T unknown Het
Piezo2 A C 18: 63,017,519 probably null Het
Pkd1l2 G T 8: 117,054,871 L812M possibly damaging Het
Plcd1 G A 9: 119,074,691 T387I probably damaging Het
Ppara C T 15: 85,787,228 S110L probably damaging Het
Ranbp9 C T 13: 43,425,114 R161Q probably damaging Het
Rufy2 G T 10: 62,997,969 R270L probably benign Het
Sept12 C T 16: 4,988,482 E272K probably damaging Het
Sgms1 T C 19: 32,159,782 E128G possibly damaging Het
Sh3bgr G A 16: 96,205,893 S21N probably benign Het
Sil1 A T 18: 35,325,413 D176E probably benign Het
Slc13a2 A T 11: 78,404,795 Y82N probably damaging Het
Slc41a1 C T 1: 131,846,632 P479L probably damaging Het
Smarca4 A G 9: 21,658,933 K744R probably damaging Het
Stxbp1 T C 2: 32,798,168 D495G probably damaging Het
Sugp2 T C 8: 70,242,844 S156P probably benign Het
Syt3 A T 7: 44,392,746 D343V probably damaging Het
Tbl3 G T 17: 24,705,291 T164N probably benign Het
Tbpl2 A T 2: 24,087,314 probably null Het
Tcf7l2 T A 19: 55,926,740 W461R unknown Het
Tmprss11c A T 5: 86,231,864 F395Y probably benign Het
Tnc A T 4: 64,014,043 Y711* probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc41 A G 10: 86,776,510 K1216E probably damaging Het
Ube2q2 A C 9: 55,163,014 D80A probably damaging Het
Ube2u A T 4: 100,532,182 K227* probably null Het
Uhrf2 T C 19: 30,071,388 Y265H possibly damaging Het
Vmn1r208 T G 13: 22,772,586 Y247S probably damaging Het
Vmn2r27 A G 6: 124,197,317 C525R probably damaging Het
Vps13a T C 19: 16,619,485 T3090A probably damaging Het
Whrn T C 4: 63,418,336 K674R probably benign Het
Zfp202 G T 9: 40,211,505 R521I probably damaging Het
Zfp433 T C 10: 81,720,825 V387A probably benign Het
Zpld1 T C 16: 55,246,683 probably null Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTATGTTCGCTCCTCAAACGAG -3'
(R):5'- GCATCCTGCCTTACCATCAG -3'

Sequencing Primer
(F):5'- TAAAGAGGTGTCTGGGCCC -3'
(R):5'- CATCAGTGGACTTGCTGGC -3'
Posted On2019-09-13