Incidental Mutation 'R7382:Tbl3'
ID572831
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7382 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24705291 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 164 (T164N)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126319
AA Change: T164N

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: T164N

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,067,269 H404Q probably damaging Het
Adam8 T A 7: 139,990,107 T82S possibly damaging Het
Adgrl2 T G 3: 148,817,283 Q435P Het
Ahr A T 12: 35,504,515 M535K probably damaging Het
Akap6 A G 12: 53,142,171 I2123V probably benign Het
Ankrd2 G T 19: 42,044,972 G318C Het
Ap4e1 T A 2: 127,008,902 probably null Het
Atp8a2 G A 14: 59,654,594 P1102S probably benign Het
Cacna2d4 C T 6: 119,239,087 S105F probably damaging Het
Cad C A 5: 31,075,829 P1872T probably benign Het
Catsperg1 A G 7: 29,204,844 F251L probably benign Het
Ccdc129 G T 6: 55,978,419 G1004V probably benign Het
Ccdc18 C A 5: 108,139,007 Q136K probably damaging Het
Cd163 A G 6: 124,311,312 probably null Het
Cd209d A T 8: 3,877,965 Y46* probably null Het
Cdk5rap2 A T 4: 70,290,025 M728K probably benign Het
Cdon A G 9: 35,478,648 D866G probably damaging Het
Cenpl A G 1: 161,078,461 H135R probably benign Het
Clstn2 A T 9: 97,799,398 L63* probably null Het
Cpeb4 A G 11: 31,872,828 T181A probably damaging Het
Dlgap1 A G 17: 70,787,174 E830G probably damaging Het
Endou T A 15: 97,718,926 K239* probably null Het
Ezh2 T C 6: 47,551,836 N263S possibly damaging Het
Fbxw2 T C 2: 34,807,302 D351G probably benign Het
Fer1l4 A T 2: 156,020,749 Y1720* probably null Het
Fmo9 A T 1: 166,663,660 probably null Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Frmpd1 T A 4: 45,278,880 V535E probably benign Het
Fxr2 T C 11: 69,641,556 V139A probably benign Het
Gm5538 T A 3: 59,743,616 M53K probably benign Het
Gpr180 T G 14: 118,162,623 V401G possibly damaging Het
Heatr5b G T 17: 78,803,507 R971S possibly damaging Het
Igkv8-34 C A 6: 70,044,119 A120S probably benign Het
Inpp5b T A 4: 124,751,577 H219Q probably benign Het
Kremen2 T C 17: 23,743,552 probably null Het
Mael G A 1: 166,201,598 P419S probably benign Het
Map1a A G 2: 121,290,785 T102A probably damaging Het
Mfsd2a A T 4: 122,952,123 I119N possibly damaging Het
Muc5b T C 7: 141,858,948 V1877A unknown Het
Myo5c A C 9: 75,304,050 S1733R probably damaging Het
Nelfcd T C 2: 174,423,383 V248A probably benign Het
Npc1 A T 18: 12,201,706 I663N probably damaging Het
Olfr1089 T C 2: 86,732,785 I276V probably benign Het
Olfr346 G T 2: 36,688,034 E11* probably null Het
Olig3 T A 10: 19,356,665 S13T unknown Het
Piezo2 A C 18: 63,017,519 probably null Het
Pkd1l2 G T 8: 117,054,871 L812M possibly damaging Het
Plcd1 G A 9: 119,074,691 T387I probably damaging Het
Ppara C T 15: 85,787,228 S110L probably damaging Het
Ranbp9 C T 13: 43,425,114 R161Q probably damaging Het
Rufy2 G T 10: 62,997,969 R270L probably benign Het
Sept12 C T 16: 4,988,482 E272K probably damaging Het
Sgms1 T C 19: 32,159,782 E128G possibly damaging Het
Sh3bgr G A 16: 96,205,893 S21N probably benign Het
Sil1 A T 18: 35,325,413 D176E probably benign Het
Slc13a2 A T 11: 78,404,795 Y82N probably damaging Het
Slc41a1 C T 1: 131,846,632 P479L probably damaging Het
Smarca4 A G 9: 21,658,933 K744R probably damaging Het
Stxbp1 T C 2: 32,798,168 D495G probably damaging Het
Sugp2 T C 8: 70,242,844 S156P probably benign Het
Syt3 A T 7: 44,392,746 D343V probably damaging Het
Tbpl2 A T 2: 24,087,314 probably null Het
Tcf7l2 T A 19: 55,926,740 W461R unknown Het
Tmprss11c A T 5: 86,231,864 F395Y probably benign Het
Tnc A T 4: 64,014,043 Y711* probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc41 A G 10: 86,776,510 K1216E probably damaging Het
Ube2q2 A C 9: 55,163,014 D80A probably damaging Het
Ube2u A T 4: 100,532,182 K227* probably null Het
Uhrf2 T C 19: 30,071,388 Y265H possibly damaging Het
Vmn1r208 T G 13: 22,772,586 Y247S probably damaging Het
Vmn2r27 A G 6: 124,197,317 C525R probably damaging Het
Vps13a T C 19: 16,619,485 T3090A probably damaging Het
Whrn T C 4: 63,418,336 K674R probably benign Het
Zfp202 G T 9: 40,211,505 R521I probably damaging Het
Zfp433 T C 10: 81,720,825 V387A probably benign Het
Zpld1 T C 16: 55,246,683 probably null Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2570:Tbl3 UTSW 17 24703316 missense possibly damaging 0.47
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3905:Tbl3 UTSW 17 24702032 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4019:Tbl3 UTSW 17 24704721 missense probably damaging 0.98
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7176:Tbl3 UTSW 17 24700758 missense probably benign 0.01
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7780:Tbl3 UTSW 17 24702231 missense probably damaging 1.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGCAGGTCCCTCTGTTGC -3'
(R):5'- TGTTTGGGACATTGTGCAAC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TTGTGCAACATTACGGGACAC -3'
Posted On2019-09-13