Incidental Mutation 'R7382:Heatr5b'
ID572833
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R7382 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78803507 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 971 (R971S)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097281
AA Change: R971S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: R971S

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,067,269 H404Q probably damaging Het
Adam8 T A 7: 139,990,107 T82S possibly damaging Het
Adgrl2 T G 3: 148,817,283 Q435P Het
Ahr A T 12: 35,504,515 M535K probably damaging Het
Akap6 A G 12: 53,142,171 I2123V probably benign Het
Ankrd2 G T 19: 42,044,972 G318C Het
Ap4e1 T A 2: 127,008,902 probably null Het
Atp8a2 G A 14: 59,654,594 P1102S probably benign Het
Cacna2d4 C T 6: 119,239,087 S105F probably damaging Het
Cad C A 5: 31,075,829 P1872T probably benign Het
Catsperg1 A G 7: 29,204,844 F251L probably benign Het
Ccdc129 G T 6: 55,978,419 G1004V probably benign Het
Ccdc18 C A 5: 108,139,007 Q136K probably damaging Het
Cd209d A T 8: 3,877,965 Y46* probably null Het
Cdk5rap2 A T 4: 70,290,025 M728K probably benign Het
Cdon A G 9: 35,478,648 D866G probably damaging Het
Cenpl A G 1: 161,078,461 H135R probably benign Het
Clstn2 A T 9: 97,799,398 L63* probably null Het
Cpeb4 A G 11: 31,872,828 T181A probably damaging Het
Dlgap1 A G 17: 70,787,174 E830G probably damaging Het
Endou T A 15: 97,718,926 K239* probably null Het
Ezh2 T C 6: 47,551,836 N263S possibly damaging Het
Fbxw2 T C 2: 34,807,302 D351G probably benign Het
Fer1l4 A T 2: 156,020,749 Y1720* probably null Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Frmpd1 T A 4: 45,278,880 V535E probably benign Het
Fxr2 T C 11: 69,641,556 V139A probably benign Het
Gm5538 T A 3: 59,743,616 M53K probably benign Het
Gpr180 T G 14: 118,162,623 V401G possibly damaging Het
Igkv8-34 C A 6: 70,044,119 A120S probably benign Het
Inpp5b T A 4: 124,751,577 H219Q probably benign Het
Mael G A 1: 166,201,598 P419S probably benign Het
Map1a A G 2: 121,290,785 T102A probably damaging Het
Mfsd2a A T 4: 122,952,123 I119N possibly damaging Het
Muc5b T C 7: 141,858,948 V1877A unknown Het
Myo5c A C 9: 75,304,050 S1733R probably damaging Het
Nelfcd T C 2: 174,423,383 V248A probably benign Het
Npc1 A T 18: 12,201,706 I663N probably damaging Het
Olfr1089 T C 2: 86,732,785 I276V probably benign Het
Olfr346 G T 2: 36,688,034 E11* probably null Het
Olig3 T A 10: 19,356,665 S13T unknown Het
Pkd1l2 G T 8: 117,054,871 L812M possibly damaging Het
Plcd1 G A 9: 119,074,691 T387I probably damaging Het
Ppara C T 15: 85,787,228 S110L probably damaging Het
Ranbp9 C T 13: 43,425,114 R161Q probably damaging Het
Rufy2 G T 10: 62,997,969 R270L probably benign Het
Sept12 C T 16: 4,988,482 E272K probably damaging Het
Sgms1 T C 19: 32,159,782 E128G possibly damaging Het
Sh3bgr G A 16: 96,205,893 S21N probably benign Het
Sil1 A T 18: 35,325,413 D176E probably benign Het
Slc13a2 A T 11: 78,404,795 Y82N probably damaging Het
Slc41a1 C T 1: 131,846,632 P479L probably damaging Het
Smarca4 A G 9: 21,658,933 K744R probably damaging Het
Stxbp1 T C 2: 32,798,168 D495G probably damaging Het
Sugp2 T C 8: 70,242,844 S156P probably benign Het
Syt3 A T 7: 44,392,746 D343V probably damaging Het
Tbl3 G T 17: 24,705,291 T164N probably benign Het
Tcf7l2 T A 19: 55,926,740 W461R unknown Het
Tmprss11c A T 5: 86,231,864 F395Y probably benign Het
Tnc A T 4: 64,014,043 Y711* probably null Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc41 A G 10: 86,776,510 K1216E probably damaging Het
Ube2q2 A C 9: 55,163,014 D80A probably damaging Het
Ube2u A T 4: 100,532,182 K227* probably null Het
Uhrf2 T C 19: 30,071,388 Y265H possibly damaging Het
Vmn1r208 T G 13: 22,772,586 Y247S probably damaging Het
Vmn2r27 A G 6: 124,197,317 C525R probably damaging Het
Vps13a T C 19: 16,619,485 T3090A probably damaging Het
Whrn T C 4: 63,418,336 K674R probably benign Het
Zfp202 G T 9: 40,211,505 R521I probably damaging Het
Zfp433 T C 10: 81,720,825 V387A probably benign Het
Zpld1 T C 16: 55,246,683 probably null Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CAGGCACTTTCTTTAACTTGAGATG -3'
(R):5'- TTCCTGGAGGCACATGAGAG -3'

Sequencing Primer
(F):5'- GAGATGAATTTGCTTACCCTGCAGC -3'
(R):5'- AAGTTCAAGGCCAGCCCAGG -3'
Posted On2019-09-13