Incidental Mutation 'R7383:Hrnr'
List |< first << previous [record 21 of 72] next >> last >|
ID572854
Institutional Source Beutler Lab
Gene Symbol Hrnr
Ensembl Gene ENSMUSG00000041991
Gene Namehornerin
Synonyms1110033K19Rik, S100a18, A530063N20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93319749-93333570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93331791 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 3112 (Q3112L)
Ref Sequence ENSEMBL: ENSMUSP00000091288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090856] [ENSMUST00000093774]
Predicted Effect unknown
Transcript: ENSMUST00000090856
AA Change: Q2935L
SMART Domains Protein: ENSMUSP00000088369
Gene: ENSMUSG00000041991
AA Change: Q2935L

DomainStartEndE-ValueType
Pfam:S_100 4 47 4.8e-15 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 7.19e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 5.7e-19 PROSPERO
internal_repeat_1 291 354 5.27e-23 PROSPERO
internal_repeat_3 301 355 9.03e-17 PROSPERO
internal_repeat_5 309 343 7.19e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2413 2447 N/A INTRINSIC
low complexity region 2457 2498 N/A INTRINSIC
low complexity region 2503 2580 N/A INTRINSIC
low complexity region 2583 2605 N/A INTRINSIC
low complexity region 2609 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2761 2795 N/A INTRINSIC
low complexity region 2805 2846 N/A INTRINSIC
low complexity region 2851 2896 N/A INTRINSIC
internal_repeat_4 2897 2968 4.19e-13 PROSPERO
internal_repeat_3 2901 2955 9.03e-17 PROSPERO
internal_repeat_2 2920 2967 5.7e-19 PROSPERO
low complexity region 2969 2985 N/A INTRINSIC
low complexity region 3016 3034 N/A INTRINSIC
internal_repeat_1 3039 3101 5.27e-23 PROSPERO
internal_repeat_4 3045 3103 4.19e-13 PROSPERO
low complexity region 3140 3153 N/A INTRINSIC
low complexity region 3163 3174 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000093774
AA Change: Q3112L
SMART Domains Protein: ENSMUSP00000091288
Gene: ENSMUSG00000041991
AA Change: Q3112L

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.1e-17 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 5.9e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 3.49e-19 PROSPERO
internal_repeat_1 291 354 2.93e-23 PROSPERO
internal_repeat_3 301 355 5.83e-17 PROSPERO
internal_repeat_5 309 343 5.9e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2276 N/A INTRINSIC
low complexity region 2286 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2412 2434 N/A INTRINSIC
low complexity region 2438 2504 N/A INTRINSIC
low complexity region 2509 2586 N/A INTRINSIC
low complexity region 2590 2624 N/A INTRINSIC
low complexity region 2634 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2760 2782 N/A INTRINSIC
low complexity region 2786 2852 N/A INTRINSIC
low complexity region 2857 2934 N/A INTRINSIC
low complexity region 2938 2972 N/A INTRINSIC
low complexity region 2982 3023 N/A INTRINSIC
low complexity region 3028 3073 N/A INTRINSIC
internal_repeat_4 3074 3145 2.96e-13 PROSPERO
internal_repeat_3 3078 3132 5.83e-17 PROSPERO
internal_repeat_2 3097 3144 3.49e-19 PROSPERO
low complexity region 3146 3162 N/A INTRINSIC
low complexity region 3193 3211 N/A INTRINSIC
internal_repeat_1 3216 3278 2.93e-23 PROSPERO
internal_repeat_4 3222 3280 2.96e-13 PROSPERO
low complexity region 3317 3330 N/A INTRINSIC
low complexity region 3340 3351 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Hrnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Hrnr APN 3 93322897 missense unknown
IGL02326:Hrnr APN 3 93323745 missense unknown
IGL03030:Hrnr APN 3 93320601 missense possibly damaging 0.91
IGL03281:Hrnr APN 3 93322851 missense probably benign 0.04
R0140:Hrnr UTSW 3 93331493 nonsense probably null
R0709:Hrnr UTSW 3 93332508 missense unknown
R1179:Hrnr UTSW 3 93332543 missense unknown
R1528:Hrnr UTSW 3 93322794 missense possibly damaging 0.56
R1640:Hrnr UTSW 3 93332516 missense unknown
R1987:Hrnr UTSW 3 93332604 missense unknown
R1988:Hrnr UTSW 3 93332604 missense unknown
R3846:Hrnr UTSW 3 93332157 missense unknown
R3871:Hrnr UTSW 3 93331874 missense unknown
R3938:Hrnr UTSW 3 93322855 missense probably benign 0.35
R4569:Hrnr UTSW 3 93323568 missense unknown
R4690:Hrnr UTSW 3 93323652 missense unknown
R4761:Hrnr UTSW 3 93322755 missense probably damaging 0.96
R5182:Hrnr UTSW 3 93332143 missense unknown
R5292:Hrnr UTSW 3 93331892 missense unknown
R5739:Hrnr UTSW 3 93323129 missense unknown
R5845:Hrnr UTSW 3 93332637 missense unknown
R5994:Hrnr UTSW 3 93332300 missense unknown
R6169:Hrnr UTSW 3 93325755 nonsense probably null
R6216:Hrnr UTSW 3 93332162 missense unknown
R6256:Hrnr UTSW 3 93322611 missense probably damaging 1.00
R6670:Hrnr UTSW 3 93331885 missense unknown
R6790:Hrnr UTSW 3 93329075 missense unknown
R6936:Hrnr UTSW 3 93332360 missense unknown
R7049:Hrnr UTSW 3 93323154 nonsense probably null
R7358:Hrnr UTSW 3 93323141 nonsense probably null
R7724:Hrnr UTSW 3 93323016 missense unknown
R7762:Hrnr UTSW 3 93332199 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGCAGAGGCAGGTCTAC -3'
(R):5'- GACTGACTTGGTCTAGATACTTGG -3'

Sequencing Primer
(F):5'- AAGGGAGTCTTCATGTTCCCAAC -3'
(R):5'- GGTCTAGATACTTGGTTACCAAAGCC -3'
Posted On2019-09-13