Mutagenetix > Incidental Mutation

Incidental Mutation 'R7383:Col24a1'

572855

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 145298838 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 26 (I26V)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: I26V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: I26V

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000139001
AA Change: Y29C

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	T	A	11: 5,868,548	I511N	probably damaging	Het
Ap5m1	T	G	14: 49,074,196	V241G	possibly damaging	Het
BC049715	T	A	6: 136,840,455	I231N	probably damaging	Het
Bckdhb	T	G	9: 83,953,713	V90G	possibly damaging	Het
Chd8	T	C	14: 52,215,319	I1248V	probably damaging	Het
Ckap2l	A	T	2: 129,269,252	M675K	possibly damaging	Het
Ckap4	A	T	10: 84,528,284	V305E	probably damaging	Het
Clasrp	C	A	7: 19,585,273	R489L	unknown	Het
Cort	C	T	4: 149,125,404	A64T	possibly damaging	Het
Dmkn	T	A	7: 30,765,368	N255K	unknown	Het
Dph2	A	T	4: 117,891,369	L69Q	probably damaging	Het
Fam129c	A	C	8: 71,603,826	E390A	possibly damaging	Het
Fbxo11	A	G	17: 88,002,854	I432T		Het
Fgd3	T	C	13: 49,268,309	K531R	possibly damaging	Het
Fgd5	A	G	6: 91,987,118	K111E	probably benign	Het
Fopnl	TTGTG	TTG	16: 14,300,145		probably null	Het
Gdf6	T	A	4: 9,859,537	D206E	probably benign	Het
Gtpbp1	T	A	15: 79,716,153	L429Q	probably damaging	Het
Hk2	A	G	6: 82,749,295	F90S	probably damaging	Het
Hrnr	A	T	3: 93,331,791	Q3112L	unknown	Het
Hsd17b4	A	C	18: 50,164,850	K402T	probably benign	Het
Htr1f	T	C	16: 64,926,843	T29A	probably benign	Het
Ikbkb	C	A	8: 22,669,050	A471S	probably benign	Het
Inpp5f	A	G	7: 128,694,586	D887G	probably damaging	Het
Ipo9	A	G	1: 135,388,673	L805P	probably damaging	Het
Jmjd1c	A	T	10: 67,189,758	N118I	probably benign	Het
Kif26b	T	G	1: 178,530,710	C129G	probably damaging	Het
Mga	G	A	2: 119,960,340	A2236T	probably damaging	Het
Micu2	T	C	14: 57,917,353	Q405R	possibly damaging	Het
Myo1e	T	A	9: 70,297,295	V59D	probably damaging	Het
Nav3	A	G	10: 109,716,671	I1770T	probably damaging	Het
Ndufa10	A	T	1: 92,464,461	I190N	probably damaging	Het
Npat	T	A	9: 53,562,778	H623Q	probably benign	Het
Npc1l1	T	C	11: 6,217,777	T1005A	probably benign	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Olfr1124	A	G	2: 87,435,377	S297G	possibly damaging	Het
Olfr124	A	G	17: 37,806,081	K312R	probably benign	Het
Olfr281	C	G	15: 98,456,697	P129R	probably damaging	Het
Olfr292	A	T	7: 86,694,752	I99F	probably damaging	Het
Olfr322	T	C	11: 58,666,185	S209P	possibly damaging	Het
Olfr381	A	G	11: 73,485,889	*312Q	probably null	Het
Pafah1b2	C	T	9: 45,968,849	G177R	probably benign	Het
Phc1	A	G	6: 122,323,358	S521P	unknown	Het
Plpp2	A	T	10: 79,531,007	L25Q	probably null	Het
Plxna4	A	G	6: 32,152,799		probably null	Het
Ppl	G	T	16: 5,097,971	P576Q	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Rbfox1	G	A	16: 7,070,035	G13S	probably benign	Het
Rhot1	C	G	11: 80,223,934	P56R	probably damaging	Het
Sipa1l2	A	G	8: 125,447,646	W1298R	probably damaging	Het
Slc16a14	G	A	1: 84,912,571	H338Y	probably damaging	Het
Slc8a3	T	G	12: 81,315,805	Y80S	probably damaging	Het
Slco6c1	A	T	1: 97,075,883	Y513*	probably null	Het
Smarcd2	A	G	11: 106,264,776	C405R	probably damaging	Het
Szt2	G	A	4: 118,365,214	R3198*	probably null	Het
Tmeff1	T	A	4: 48,636,841	C180S	probably damaging	Het
Tmem132a	A	T	19: 10,866,994	M80K	probably benign	Het
Tnfsf12	A	G	11: 69,687,066	V175A	probably damaging	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Togaram2	A	T	17: 71,700,517	I354F	probably damaging	Het
Uchl5	T	A	1: 143,784,015	S42R	probably benign	Het
Virma	C	A	4: 11,514,026	L627I	probably damaging	Het
Vmn2r12	A	T	5: 109,092,818	I143K	probably benign	Het
Vmn2r95	T	G	17: 18,440,472	V382G	probably benign	Het
Wipf3	G	T	6: 54,485,278	A158S	probably benign	Het
Ylpm1	T	G	12: 85,044,468	S1809A	possibly damaging	Het
Zdhhc5	A	T	2: 84,694,404	C191S	probably benign	Het
Zer1	G	A	2: 30,111,241	R84C	probably damaging	Het
Zfhx2	A	T	14: 55,068,253	V991D	probably benign	Het
Zscan4b	C	A	7: 10,904,033	M61I	possibly damaging	Het
Zswim2	A	T	2: 83,915,328	S589T	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGAACACGGCTCATTCTAAAG -3'
(R):5'- CTGTTGCAAGCAGAAATGCTG -3'

Sequencing Primer
(F):5'- TCATTCTAAAGCGGTGGACC -3'
(R):5'- TGTGCAGCATCCGCAAATG -3'

Posted On

2019-09-13