Incidental Mutation 'R7383:Virma'
ID572857
Institutional Source Beutler Lab
Gene Symbol Virma
Ensembl Gene ENSMUSG00000040720
Gene Namevir like m6A methyltransferase associated
Synonyms1110037F02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11485958-11550684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11514026 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 627 (L627I)
Ref Sequence ENSEMBL: ENSMUSP00000063188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]
Predicted Effect probably damaging
Transcript: ENSMUST00000055372
AA Change: L627I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720
AA Change: L627I

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059914
AA Change: L627I

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: L627I

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1224 1232 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
low complexity region 1460 1474 N/A INTRINSIC
low complexity region 1618 1634 N/A INTRINSIC
low complexity region 1684 1697 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
low complexity region 1796 1808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108307
AA Change: L627I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: L627I

DomainStartEndE-ValueType
Pfam:VIR_N 5 266 2e-110 PFAM
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1058 1070 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1274 1282 N/A INTRINSIC
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1668 1684 N/A INTRINSIC
low complexity region 1734 1747 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Virma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Virma APN 4 11519424 splice site probably benign
IGL00477:Virma APN 4 11519006 missense probably damaging 0.99
IGL01293:Virma APN 4 11521114 missense probably damaging 1.00
IGL01410:Virma APN 4 11518929 nonsense probably null
IGL01531:Virma APN 4 11528753 missense probably damaging 1.00
IGL01672:Virma APN 4 11527792 missense probably damaging 1.00
IGL01724:Virma APN 4 11528672 missense probably damaging 1.00
IGL01747:Virma APN 4 11526877 missense probably damaging 1.00
IGL01776:Virma APN 4 11527792 missense probably damaging 1.00
IGL02064:Virma APN 4 11513163 missense possibly damaging 0.87
IGL02243:Virma APN 4 11546031 missense probably damaging 1.00
IGL02244:Virma APN 4 11546031 missense probably damaging 1.00
IGL02445:Virma APN 4 11527029 missense probably damaging 0.97
IGL02546:Virma APN 4 11494804 missense probably damaging 0.99
IGL02807:Virma APN 4 11507079 splice site probably benign
IGL02967:Virma APN 4 11514096 missense probably benign 0.01
IGL03211:Virma APN 4 11548770 nonsense probably null
IGL03242:Virma APN 4 11527669 missense possibly damaging 0.70
IGL03256:Virma APN 4 11542207 splice site probably benign
IGL03327:Virma APN 4 11518984 missense probably benign 0.00
IGL03346:Virma APN 4 11518984 missense probably benign 0.00
PIT4802001:Virma UTSW 4 11546008 missense probably damaging 0.99
R0142:Virma UTSW 4 11548783 missense probably benign 0.04
R0355:Virma UTSW 4 11528626 nonsense probably null
R0522:Virma UTSW 4 11519416 critical splice donor site probably null
R0600:Virma UTSW 4 11498769 missense probably damaging 0.99
R1435:Virma UTSW 4 11528621 missense probably damaging 1.00
R1489:Virma UTSW 4 11521164 missense probably damaging 1.00
R1568:Virma UTSW 4 11528776 missense probably damaging 0.99
R1616:Virma UTSW 4 11544954 missense probably damaging 1.00
R1655:Virma UTSW 4 11494786 missense probably damaging 1.00
R1695:Virma UTSW 4 11494814 missense probably damaging 0.98
R1835:Virma UTSW 4 11540511 missense probably benign 0.02
R1951:Virma UTSW 4 11513907 missense probably benign 0.00
R1991:Virma UTSW 4 11519242 missense probably benign 0.06
R2145:Virma UTSW 4 11548726 splice site probably benign
R2172:Virma UTSW 4 11527843 missense possibly damaging 0.82
R2217:Virma UTSW 4 11544924 missense probably damaging 1.00
R2218:Virma UTSW 4 11544924 missense probably damaging 1.00
R2248:Virma UTSW 4 11518927 missense probably damaging 1.00
R2342:Virma UTSW 4 11501316 missense probably damaging 1.00
R3424:Virma UTSW 4 11513177 nonsense probably null
R4397:Virma UTSW 4 11513901 missense possibly damaging 0.81
R4449:Virma UTSW 4 11498828 critical splice donor site probably null
R4660:Virma UTSW 4 11513505 missense probably damaging 1.00
R4698:Virma UTSW 4 11528636 missense probably damaging 0.99
R4878:Virma UTSW 4 11544971 missense probably damaging 1.00
R4937:Virma UTSW 4 11521147 nonsense probably null
R5031:Virma UTSW 4 11542116 nonsense probably null
R5040:Virma UTSW 4 11528746 missense probably benign 0.01
R5061:Virma UTSW 4 11494840 missense possibly damaging 0.95
R5091:Virma UTSW 4 11519392 missense probably benign 0.00
R5137:Virma UTSW 4 11546297 missense probably damaging 1.00
R5262:Virma UTSW 4 11539926 missense probably benign 0.01
R5297:Virma UTSW 4 11494819 missense probably damaging 1.00
R5730:Virma UTSW 4 11542154 missense probably benign 0.44
R5818:Virma UTSW 4 11513319 missense possibly damaging 0.92
R5835:Virma UTSW 4 11514036 missense probably damaging 1.00
R6125:Virma UTSW 4 11521172 missense probably damaging 0.98
R6197:Virma UTSW 4 11505498 missense probably damaging 0.96
R6222:Virma UTSW 4 11527820 missense probably damaging 1.00
R6793:Virma UTSW 4 11539968 missense probably damaging 1.00
R7028:Virma UTSW 4 11519249 missense possibly damaging 0.50
R7356:Virma UTSW 4 11513595 missense probably damaging 0.99
R7391:Virma UTSW 4 11508099 missense probably damaging 0.99
R7425:Virma UTSW 4 11546211 missense possibly damaging 0.95
R7556:Virma UTSW 4 11518927 missense probably damaging 1.00
R7715:Virma UTSW 4 11549682 missense probably damaging 1.00
X0020:Virma UTSW 4 11486055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGACTGTGAGGGTTGTCACTG -3'
(R):5'- TGTGATCCAAAAGCCAAGTATACC -3'

Sequencing Primer
(F):5'- GGCTCAGCTATTCTTCAAAAATGCC -3'
(R):5'- AGCCAAGTATACCTTACCTAAAGAG -3'
Posted On2019-09-13