Mutagenetix > Incidental Mutation

Incidental Mutation 'R7383:Szt2'

572860

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.710) question?

Stock #

R7383 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 118365214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 3198 (R3198*)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006562] [ENSMUST00000075406] [ENSMUST00000106393] [ENSMUST00000194248]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000006562

SMART Domains

Protein: ENSMUSP00000006562
Gene: ENSMUSG00000006395

Domain	Start	End	E-Value	Type
Pfam:AP_endonuc_2	24	221	4.2e-28	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000075406
AA Change: R3198*

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: R3198*

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106393

SMART Domains

Protein: ENSMUSP00000102001
Gene: ENSMUSG00000006395

Domain	Start	End	E-Value	Type
SCOP:d1k77a_	4	67	4e-10	SMART
PDB:1K77\|A	5	69	5e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000183402

Predicted Effect

probably benign
Transcript: ENSMUST00000194248

SMART Domains

Protein: ENSMUSP00000141952
Gene: ENSMUSG00000006395

Domain	Start	End	E-Value	Type
SCOP:d1k77a_	4	77	3e-10	SMART
PDB:1K77\|A	5	76	6e-8	PDB
low complexity region	246	260	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	T	A	11: 5,868,548	I511N	probably damaging	Het
Ap5m1	T	G	14: 49,074,196	V241G	possibly damaging	Het
BC049715	T	A	6: 136,840,455	I231N	probably damaging	Het
Bckdhb	T	G	9: 83,953,713	V90G	possibly damaging	Het
Chd8	T	C	14: 52,215,319	I1248V	probably damaging	Het
Ckap2l	A	T	2: 129,269,252	M675K	possibly damaging	Het
Ckap4	A	T	10: 84,528,284	V305E	probably damaging	Het
Clasrp	C	A	7: 19,585,273	R489L	unknown	Het
Col24a1	A	G	3: 145,298,838	I26V	probably benign	Het
Cort	C	T	4: 149,125,404	A64T	possibly damaging	Het
Dmkn	T	A	7: 30,765,368	N255K	unknown	Het
Dph2	A	T	4: 117,891,369	L69Q	probably damaging	Het
Fam129c	A	C	8: 71,603,826	E390A	possibly damaging	Het
Fbxo11	A	G	17: 88,002,854	I432T		Het
Fgd3	T	C	13: 49,268,309	K531R	possibly damaging	Het
Fgd5	A	G	6: 91,987,118	K111E	probably benign	Het
Fopnl	TTGTG	TTG	16: 14,300,145		probably null	Het
Gdf6	T	A	4: 9,859,537	D206E	probably benign	Het
Gtpbp1	T	A	15: 79,716,153	L429Q	probably damaging	Het
Hk2	A	G	6: 82,749,295	F90S	probably damaging	Het
Hrnr	A	T	3: 93,331,791	Q3112L	unknown	Het
Hsd17b4	A	C	18: 50,164,850	K402T	probably benign	Het
Htr1f	T	C	16: 64,926,843	T29A	probably benign	Het
Ikbkb	C	A	8: 22,669,050	A471S	probably benign	Het
Inpp5f	A	G	7: 128,694,586	D887G	probably damaging	Het
Ipo9	A	G	1: 135,388,673	L805P	probably damaging	Het
Jmjd1c	A	T	10: 67,189,758	N118I	probably benign	Het
Kif26b	T	G	1: 178,530,710	C129G	probably damaging	Het
Mga	G	A	2: 119,960,340	A2236T	probably damaging	Het
Micu2	T	C	14: 57,917,353	Q405R	possibly damaging	Het
Myo1e	T	A	9: 70,297,295	V59D	probably damaging	Het
Nav3	A	G	10: 109,716,671	I1770T	probably damaging	Het
Ndufa10	A	T	1: 92,464,461	I190N	probably damaging	Het
Npat	T	A	9: 53,562,778	H623Q	probably benign	Het
Npc1l1	T	C	11: 6,217,777	T1005A	probably benign	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Olfr1124	A	G	2: 87,435,377	S297G	possibly damaging	Het
Olfr124	A	G	17: 37,806,081	K312R	probably benign	Het
Olfr281	C	G	15: 98,456,697	P129R	probably damaging	Het
Olfr292	A	T	7: 86,694,752	I99F	probably damaging	Het
Olfr322	T	C	11: 58,666,185	S209P	possibly damaging	Het
Olfr381	A	G	11: 73,485,889	*312Q	probably null	Het
Pafah1b2	C	T	9: 45,968,849	G177R	probably benign	Het
Phc1	A	G	6: 122,323,358	S521P	unknown	Het
Plpp2	A	T	10: 79,531,007	L25Q	probably null	Het
Plxna4	A	G	6: 32,152,799		probably null	Het
Ppl	G	T	16: 5,097,971	P576Q	probably damaging	Het
Rab38	T	C	7: 88,430,429	Y10H	possibly damaging	Het
Rbfox1	G	A	16: 7,070,035	G13S	probably benign	Het
Rhot1	C	G	11: 80,223,934	P56R	probably damaging	Het
Sipa1l2	A	G	8: 125,447,646	W1298R	probably damaging	Het
Slc16a14	G	A	1: 84,912,571	H338Y	probably damaging	Het
Slc8a3	T	G	12: 81,315,805	Y80S	probably damaging	Het
Slco6c1	A	T	1: 97,075,883	Y513*	probably null	Het
Smarcd2	A	G	11: 106,264,776	C405R	probably damaging	Het
Tmeff1	T	A	4: 48,636,841	C180S	probably damaging	Het
Tmem132a	A	T	19: 10,866,994	M80K	probably benign	Het
Tnfsf12	A	G	11: 69,687,066	V175A	probably damaging	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Togaram2	A	T	17: 71,700,517	I354F	probably damaging	Het
Uchl5	T	A	1: 143,784,015	S42R	probably benign	Het
Virma	C	A	4: 11,514,026	L627I	probably damaging	Het
Vmn2r12	A	T	5: 109,092,818	I143K	probably benign	Het
Vmn2r95	T	G	17: 18,440,472	V382G	probably benign	Het
Wipf3	G	T	6: 54,485,278	A158S	probably benign	Het
Ylpm1	T	G	12: 85,044,468	S1809A	possibly damaging	Het
Zdhhc5	A	T	2: 84,694,404	C191S	probably benign	Het
Zer1	G	A	2: 30,111,241	R84C	probably damaging	Het
Zfhx2	A	T	14: 55,068,253	V991D	probably benign	Het
Zscan4b	C	A	7: 10,904,033	M61I	possibly damaging	Het
Zswim2	A	T	2: 83,915,328	S589T	possibly damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCACTTCTGCAGCCAATG -3'
(R):5'- CGGCATCAGGATGACTTTGATG -3'

Sequencing Primer
(F):5'- CTTCTGCAGCCAATGGTGGG -3'
(R):5'- CATCAGGATGACTTTGATGTGTCTC -3'

Posted On

2019-09-13