Incidental Mutation 'R7383:Wipf3'
ID572864
Institutional Source Beutler Lab
Gene Symbol Wipf3
Ensembl Gene ENSMUSG00000086040
Gene NameWAS/WASL interacting protein family, member 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location54429603-54503768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54485278 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 158 (A158S)
Ref Sequence ENSEMBL: ENSMUSP00000120240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126637] [ENSMUST00000132855] [ENSMUST00000163746] [ENSMUST00000172046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000126637
AA Change: A158S

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116325
Gene: ENSMUSG00000086040
AA Change: A158S

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132855
AA Change: A158S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120240
Gene: ENSMUSG00000086040
AA Change: A158S

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163746
AA Change: A158S

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132022
Gene: ENSMUSG00000086040
AA Change: A158S

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172046
AA Change: A158S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132138
Gene: ENSMUSG00000086040
AA Change: A158S

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display impaired spermatogenesis, abnormal sperm head morphology, and significantly reduced male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Wipf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0427:Wipf3 UTSW 6 54483897 missense possibly damaging 0.65
R0529:Wipf3 UTSW 6 54485363 missense probably damaging 0.97
R0699:Wipf3 UTSW 6 54483832 missense probably damaging 0.99
R2246:Wipf3 UTSW 6 54489073 missense probably damaging 0.99
R3809:Wipf3 UTSW 6 54481795 missense probably damaging 0.96
R4037:Wipf3 UTSW 6 54481828 missense probably damaging 1.00
R4038:Wipf3 UTSW 6 54481828 missense probably damaging 1.00
R4613:Wipf3 UTSW 6 54485555 missense probably damaging 1.00
R5144:Wipf3 UTSW 6 54485675 missense probably damaging 1.00
R5408:Wipf3 UTSW 6 54481911 missense probably benign 0.25
R5464:Wipf3 UTSW 6 54485323 missense possibly damaging 0.46
R7116:Wipf3 UTSW 6 54481919 critical splice donor site probably null
R7577:Wipf3 UTSW 6 54485524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AATGGGCCTGCACAGTCTAC -3'
(R):5'- CAGATGGATTCACCTTGGTTGG -3'

Sequencing Primer
(F):5'- CTCAGCAGCAGGGACATC -3'
(R):5'- CACCTTGGTTGGAGGGGC -3'
Posted On2019-09-13