Incidental Mutation 'R7383:Hk2'
ID572865
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Namehexokinase 2
SynonymsHKII
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location82725025-82774454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82749295 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 90 (F90S)
Ref Sequence ENSEMBL: ENSMUSP00000000642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
Predicted Effect probably damaging
Transcript: ENSMUST00000000642
AA Change: F90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628
AA Change: F90S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170833
AA Change: F62S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628
AA Change: F62S

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0081:Hk2 UTSW 6 82734976 splice site probably benign
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3856:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
R7340:Hk2 UTSW 6 82728892 missense probably benign 0.00
R7417:Hk2 UTSW 6 82743345 missense probably damaging 1.00
R7481:Hk2 UTSW 6 82760169 missense probably benign 0.09
R7495:Hk2 UTSW 6 82727365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAATAGTCAAGGCTCCCAC -3'
(R):5'- AAAAGTGAGCCAGTTGCCC -3'

Sequencing Primer
(F):5'- ACAGTGTCCAGGATGTCCTAG -3'
(R):5'- AGCCAGTTGCCCACCCTC -3'
Posted On2019-09-13