Incidental Mutation 'R7383:Rab38'
ID572873
Institutional Source Beutler Lab
Gene Symbol Rab38
Ensembl Gene ENSMUSG00000030559
Gene NameRAB38, member RAS oncogene family
Synonyms2310011F14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028238; MGI: 1919683

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location88430273-88491572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88430429 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 10 (Y10H)
Ref Sequence ENSEMBL: ENSMUSP00000102877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107256] [ENSMUST00000208478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107256
AA Change: Y10H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102877
Gene: ENSMUSG00000030559
AA Change: Y10H

DomainStartEndE-ValueType
RAB 10 180 8.9e-84 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208478
AA Change: Y10H

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation display oculocutaneous albinism, abnormal lung alveolar structure and aberrant pulmonary surfactant homeostasis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Spontaneous(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Rab38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Rab38 APN 7 88430532 missense probably damaging 1.00
Fenrir UTSW 7 88450541 missense probably damaging 1.00
3370:Rab38 UTSW 7 88490651 missense probably benign 0.00
R0130:Rab38 UTSW 7 88450541 missense probably damaging 1.00
R1842:Rab38 UTSW 7 88450522 missense possibly damaging 0.88
R1893:Rab38 UTSW 7 88490716 missense probably benign
R4448:Rab38 UTSW 7 88490625 missense probably benign 0.01
R4635:Rab38 UTSW 7 88450646 missense probably damaging 0.99
R5555:Rab38 UTSW 7 88430487 missense probably damaging 0.99
R6415:Rab38 UTSW 7 88430540 missense possibly damaging 0.95
R6838:Rab38 UTSW 7 88450709 missense possibly damaging 0.94
R7650:Rab38 UTSW 7 88430429 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGCTTCCAGTCCCAGGAGTTG -3'
(R):5'- AATGTCCCAGAGCTGCAAGC -3'

Sequencing Primer
(F):5'- CAGTCCCAGGAGTTGCTCTTG -3'
(R):5'- AAGCGCACCACCGTCTCTG -3'
Posted On2019-09-13