Incidental Mutation 'R0647:Irx2'
ID 57288
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene Name Iroquois homeobox 2
Synonyms IRX6
MMRRC Submission 038832-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.715) question?
Stock # R0647 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 72776939-72782317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 72778799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 121 (N121T)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
AlphaFold P81066
Predicted Effect probably damaging
Transcript: ENSMUST00000074372
AA Change: N121T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: N121T

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
AA Change: N27T

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504
AA Change: N27T

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 C A 11: 50,494,265 (GRCm39) T113K probably damaging Het
Adgre1 T A 17: 57,718,003 (GRCm39) N338K probably damaging Het
Aggf1 A T 13: 95,508,164 (GRCm39) probably null Het
Apc2 A T 10: 80,140,762 (GRCm39) I206F probably damaging Het
Carmil3 T C 14: 55,739,892 (GRCm39) probably null Het
Ccdc110 A C 8: 46,396,425 (GRCm39) E772A probably damaging Het
Cdh23 A G 10: 60,143,681 (GRCm39) F2977L probably damaging Het
Cdh23 A T 10: 60,159,153 (GRCm39) Y2207* probably null Het
Cfap20dc T A 14: 8,536,655 (GRCm38) D184V possibly damaging Het
Chd4 T A 6: 125,086,086 (GRCm39) N908K probably damaging Het
Chst9 A G 18: 15,585,726 (GRCm39) I279T probably damaging Het
Ctnna3 A T 10: 63,656,203 (GRCm39) N261I probably benign Het
Dlgap2 A T 8: 14,777,591 (GRCm39) S279C possibly damaging Het
Dock4 G A 12: 40,760,883 (GRCm39) E524K probably damaging Het
Fabp12 T A 3: 10,311,096 (GRCm39) N122I possibly damaging Het
Fam184b T C 5: 45,741,932 (GRCm39) T100A probably benign Het
Fbxl5 T C 5: 43,925,411 (GRCm39) D176G probably damaging Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Foxe1 A G 4: 46,344,477 (GRCm39) N95S possibly damaging Het
Frem3 A G 8: 81,341,814 (GRCm39) E1369G probably damaging Het
Frmpd4 C T X: 166,272,006 (GRCm39) E483K probably damaging Het
Gbp11 T C 5: 105,478,830 (GRCm39) K203E possibly damaging Het
Hs3st6 C T 17: 24,977,134 (GRCm39) R205C probably damaging Het
Ifitm10 C T 7: 141,909,772 (GRCm39) S179N probably damaging Het
Itih1 A T 14: 30,657,820 (GRCm39) V417E probably damaging Het
Itpr1 A C 6: 108,360,659 (GRCm39) E695A probably damaging Het
Kif1c T A 11: 70,616,967 (GRCm39) I755K probably damaging Het
Lamb3 A G 1: 193,013,104 (GRCm39) E443G probably damaging Het
Lrp1 G C 10: 127,407,346 (GRCm39) T1865R probably damaging Het
Lrrc8b T A 5: 105,628,473 (GRCm39) I273K possibly damaging Het
Ly9 T C 1: 171,427,376 (GRCm39) Y393C probably damaging Het
Mphosph8 T C 14: 56,911,862 (GRCm39) V295A probably benign Het
Nlrp5 T A 7: 23,117,132 (GRCm39) D269E probably damaging Het
Or1r1 G A 11: 73,874,597 (GRCm39) A279V probably damaging Het
Or2t6 T G 14: 14,175,858 (GRCm38) T75P probably benign Het
Or4k44 A G 2: 111,367,704 (GRCm39) V310A probably benign Het
Or52u1 T G 7: 104,237,322 (GRCm39) F104V probably damaging Het
Or5p50 T A 7: 107,422,218 (GRCm39) I153F probably benign Het
Otud3 A G 4: 138,640,948 (GRCm39) L64P probably damaging Het
Pcdh17 A T 14: 84,685,213 (GRCm39) H560L possibly damaging Het
Pcdhb21 T C 18: 37,646,913 (GRCm39) V14A probably damaging Het
Prss3l A T 6: 41,420,275 (GRCm39) F150L probably benign Het
Rbfox1 A T 16: 7,042,248 (GRCm39) Q14L probably damaging Het
Rbm44 A G 1: 91,084,650 (GRCm39) D665G probably benign Het
Rc3h2 C T 2: 37,299,542 (GRCm39) V163M probably damaging Het
Sash1 T A 10: 8,605,316 (GRCm39) R1025W probably damaging Het
Sgpl1 A G 10: 60,949,267 (GRCm39) S146P probably damaging Het
Slc27a2 G A 2: 126,429,836 (GRCm39) D615N probably benign Het
Smap1 A G 1: 23,892,559 (GRCm39) I135T probably damaging Het
Snapc3 A G 4: 83,368,466 (GRCm39) D321G probably damaging Het
St6galnac4 C T 2: 32,479,460 (GRCm39) R6C probably damaging Het
Syne2 C T 12: 75,934,977 (GRCm39) P153L probably benign Het
Tiprl A G 1: 165,050,092 (GRCm39) probably null Het
Tmem94 A G 11: 115,687,621 (GRCm39) N1160S probably damaging Het
Trim65 G A 11: 116,019,036 (GRCm39) R168C possibly damaging Het
Txndc16 A T 14: 45,406,732 (GRCm39) I241N probably damaging Het
Txndc16 T A 14: 45,402,818 (GRCm39) R101* probably null Het
Ugt2b38 A G 5: 87,571,328 (GRCm39) S235P probably benign Het
Ugt3a1 A T 15: 9,310,635 (GRCm39) M306L probably benign Het
Vmn1r23 T A 6: 57,903,169 (GRCm39) Y203F probably benign Het
Vmn2r3 T A 3: 64,183,046 (GRCm39) I218F probably damaging Het
Wdfy4 A G 14: 32,831,656 (GRCm39) C857R possibly damaging Het
Zfp493 A C 13: 67,931,994 (GRCm39) K31T possibly damaging Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72,779,429 (GRCm39) missense probably damaging 1.00
R0783:Irx2 UTSW 13 72,780,769 (GRCm39) critical splice donor site probably null
R0931:Irx2 UTSW 13 72,779,675 (GRCm39) missense possibly damaging 0.71
R0932:Irx2 UTSW 13 72,779,675 (GRCm39) missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72,779,585 (GRCm39) missense probably benign 0.19
R2844:Irx2 UTSW 13 72,779,709 (GRCm39) missense probably damaging 1.00
R4656:Irx2 UTSW 13 72,779,417 (GRCm39) missense probably damaging 1.00
R4963:Irx2 UTSW 13 72,780,729 (GRCm39) missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72,779,420 (GRCm39) missense probably damaging 1.00
R5523:Irx2 UTSW 13 72,779,714 (GRCm39) missense probably damaging 1.00
R6663:Irx2 UTSW 13 72,777,248 (GRCm39) missense probably damaging 1.00
R7311:Irx2 UTSW 13 72,779,396 (GRCm39) missense probably damaging 0.98
R7411:Irx2 UTSW 13 72,777,182 (GRCm39) start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72,778,739 (GRCm39) missense probably damaging 1.00
R7506:Irx2 UTSW 13 72,777,328 (GRCm39) missense probably damaging 1.00
R7792:Irx2 UTSW 13 72,779,493 (GRCm39) missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72,777,343 (GRCm39) missense probably benign 0.02
R9083:Irx2 UTSW 13 72,777,392 (GRCm39) missense possibly damaging 0.94
Z1177:Irx2 UTSW 13 72,777,208 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTTCCAACCCAGAGAAGCCTAGC -3'
(R):5'- AAATGCGGCCCAGCATCTCTAC -3'

Sequencing Primer
(F):5'- CCTAGCAGGAAAGGCAGC -3'
(R):5'- GAAAGCTCCCTGAGCCTTC -3'
Posted On 2013-07-11