Incidental Mutation 'R7383:Bckdhb'
ID572882
Institutional Source Beutler Lab
Gene Symbol Bckdhb
Ensembl Gene ENSMUSG00000032263
Gene Namebranched chain ketoacid dehydrogenase E1, beta polypeptide
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location83925145-84124240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83953713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 90 (V90G)
Ref Sequence ENSEMBL: ENSMUSP00000139684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034801] [ENSMUST00000190166] [ENSMUST00000190637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034801
AA Change: V22G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034801
Gene: ENSMUSG00000032263
AA Change: V22G

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 312 1.5e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190166
AA Change: V22G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140598
Gene: ENSMUSG00000032263
AA Change: V22G

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 309 3.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190637
AA Change: V90G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139684
Gene: ENSMUSG00000032263
AA Change: V90G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Transket_pyr 69 244 4.92e-60 SMART
Pfam:Transketolase_C 259 377 1.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta chain of the branched chain alpha ketoacid dehydrogenase (Bckdh) complex. The encoded protein exists in a heterotetrameric complex containing the Bckdh alpha subunit to form the E1 catalytic component of Bckdh complex. The Bckdh complex catalyzes the oxidative decarboxylation of branched chain ketoacids to their corresponding acyl-CoA esters, during the catabolism of leucine, isoleucine and valine. In humans, certain mutations in this gene cause maple syrup urine disease. Alternative splicing results in multiple transcript variants encoding different isoforms. A pseudogene for this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Bckdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Bckdhb APN 9 83991736 missense probably benign
IGL02537:Bckdhb APN 9 83989141 missense probably benign 0.07
IGL02808:Bckdhb APN 9 83988845 missense probably benign 0.05
R0608:Bckdhb UTSW 9 83953736 missense probably damaging 1.00
R1780:Bckdhb UTSW 9 83953783 critical splice donor site probably null
R3892:Bckdhb UTSW 9 83988810 missense probably damaging 1.00
R4825:Bckdhb UTSW 9 83988905 missense probably damaging 1.00
R6018:Bckdhb UTSW 9 84069184 missense probably benign 0.41
R6823:Bckdhb UTSW 9 83953761 missense possibly damaging 0.76
R7350:Bckdhb UTSW 9 84010326 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTTGATCTTGCTGAGTTCTTAAAG -3'
(R):5'- TTGGAGAAACCCAGCCCATAG -3'

Sequencing Primer
(F):5'- ATCTTGCTGAGTTCTTAAAGTTTGG -3'
(R):5'- GTGTTGCCAAAATAAAAGGAACCC -3'
Posted On2019-09-13