Incidental Mutation 'R7383:Npc1l1'
ID572888
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6217777 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1005 (T1005A)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect probably benign
Transcript: ENSMUST00000004505
AA Change: T1005A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: T1005A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1944:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTTGTCCTGTCAGTCC -3'
(R):5'- CATTTCTTGACCCCACAACTGG -3'

Sequencing Primer
(F):5'- TCACTGTGCCCCAGAAAGG -3'
(R):5'- GGGGTGGCAGGTGTAAACCTC -3'
Posted On2019-09-13