Incidental Mutation 'R7383:Olfr381'
ID572891
Institutional Source Beutler Lab
Gene Symbol Olfr381
Ensembl Gene ENSMUSG00000072708
Gene Nameolfactory receptor 381
SynonymsGA_x6K02T2P1NL-3646409-3645474, MOR135-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73484274-73491603 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 73485889 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 312 (*312Q)
Ref Sequence ENSEMBL: ENSMUSP00000113846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078358] [ENSMUST00000119863] [ENSMUST00000214623] [ENSMUST00000215358]
Predicted Effect probably null
Transcript: ENSMUST00000078358
AA Change: *312Q
SMART Domains Protein: ENSMUSP00000077467
Gene: ENSMUSG00000072708
AA Change: *312Q

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.3e-35 PFAM
Pfam:7tm_4 139 283 5.3e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119863
AA Change: *312Q
SMART Domains Protein: ENSMUSP00000113846
Gene: ENSMUSG00000072708
AA Change: *312Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-57 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214623
AA Change: *312Q
Predicted Effect probably null
Transcript: ENSMUST00000215358
AA Change: *312Q
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Olfr381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr381 APN 11 73486572 missense probably benign 0.22
IGL02867:Olfr381 APN 11 73485991 missense probably damaging 1.00
IGL03202:Olfr381 APN 11 73486525 nonsense probably null
R0207:Olfr381 UTSW 11 73486575 missense probably benign 0.00
R0539:Olfr381 UTSW 11 73486063 missense probably benign 0.22
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1469:Olfr381 UTSW 11 73486323 missense possibly damaging 0.81
R1835:Olfr381 UTSW 11 73486374 missense probably benign 0.08
R2095:Olfr381 UTSW 11 73486594 missense probably damaging 1.00
R3612:Olfr381 UTSW 11 73485940 missense probably benign 0.23
R3983:Olfr381 UTSW 11 73486135 missense possibly damaging 0.84
R4959:Olfr381 UTSW 11 73486067 nonsense probably null
R4983:Olfr381 UTSW 11 73486797 missense probably benign 0.04
R5297:Olfr381 UTSW 11 73486389 missense probably damaging 0.99
R5447:Olfr381 UTSW 11 73486176 missense probably benign 0.01
R5569:Olfr381 UTSW 11 73486692 missense probably damaging 0.97
R5580:Olfr381 UTSW 11 73486210 missense probably benign
R5711:Olfr381 UTSW 11 73486182 missense probably damaging 1.00
R5810:Olfr381 UTSW 11 73486095 nonsense probably null
R6974:Olfr381 UTSW 11 73486473 missense probably benign 0.00
R7661:Olfr381 UTSW 11 73486600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGGGCATTCTCTGAATGG -3'
(R):5'- ACACCTATCTGTGGTCTCACTG -3'

Sequencing Primer
(F):5'- TGAATGGCCTTTCCTTCAGTC -3'
(R):5'- GGTCTCACTGTTCTATGGGAC -3'
Posted On2019-09-13