Incidental Mutation 'R7383:Fgd3'
ID572896
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49268309 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 531 (K531R)
Ref Sequence ENSEMBL: ENSMUSP00000048692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048716
AA Change: K531R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: K531R

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110087
AA Change: K531R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: K531R

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0526:Fgd3 UTSW 13 49296524 missense probably benign 0.00
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1529:Fgd3 UTSW 13 49266694 missense probably benign 0.19
R1577:Fgd3 UTSW 13 49281937 missense probably damaging 0.99
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R5753:Fgd3 UTSW 13 49274940 missense possibly damaging 0.94
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAGGATCTAGAGGCAGCCTTG -3'
(R):5'- CATACATGGCCACTTGCAGG -3'

Sequencing Primer
(F):5'- CGTGCACAGTACTCTCAAGAAGTG -3'
(R):5'- ATGGCCACTTGCAGGATCCTTAG -3'
Posted On2019-09-13