Incidental Mutation 'R7383:Gtpbp1'
ID572901
Institutional Source Beutler Lab
Gene Symbol Gtpbp1
Ensembl Gene ENSMUSG00000042535
Gene NameGTP binding protein 1
SynonymsGP-1, GTPBP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79690845-79721479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79716153 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 429 (L429Q)
Ref Sequence ENSEMBL: ENSMUSP00000043575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000230262] [ENSMUST00000231095]
PDB Structure
Murine Alloreactive ScFv TCR-Peptide-MHC Class I Molecule Complex [X-RAY DIFFRACTION]
Mhc Class I H-2Kb molecule complexed with pKB1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000046463
AA Change: L429Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: L429Q

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
Pfam:GTP_EFTU 160 385 2.7e-24 PFAM
low complexity region 402 420 N/A INTRINSIC
SCOP:d1exma2 491 575 4e-19 SMART
low complexity region 605 619 N/A INTRINSIC
low complexity region 645 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228991
Predicted Effect probably benign
Transcript: ENSMUST00000229583
Predicted Effect probably benign
Transcript: ENSMUST00000230262
Predicted Effect probably benign
Transcript: ENSMUST00000231095
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Gtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Gtpbp1 APN 15 79719136 missense possibly damaging 0.90
IGL01783:Gtpbp1 APN 15 79716197 missense probably damaging 1.00
IGL01794:Gtpbp1 APN 15 79716246 missense probably damaging 1.00
IGL01859:Gtpbp1 APN 15 79719140 missense probably benign
IGL02245:Gtpbp1 APN 15 79690926 missense probably benign 0.02
IGL02532:Gtpbp1 APN 15 79720077 missense probably benign 0.05
IGL02730:Gtpbp1 APN 15 79719171 missense probably benign
IGL02796:Gtpbp1 UTSW 15 79716985 missense possibly damaging 0.83
R0525:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0531:Gtpbp1 UTSW 15 79720091 missense probably damaging 1.00
R0535:Gtpbp1 UTSW 15 79707732 missense probably damaging 1.00
R0665:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0760:Gtpbp1 UTSW 15 79719155 missense probably damaging 0.99
R0799:Gtpbp1 UTSW 15 79716200 missense probably damaging 1.00
R1445:Gtpbp1 UTSW 15 79713448 missense possibly damaging 0.82
R1458:Gtpbp1 UTSW 15 79707729 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1498:Gtpbp1 UTSW 15 79719021 splice site probably null
R1567:Gtpbp1 UTSW 15 79712190 missense probably damaging 0.98
R3028:Gtpbp1 UTSW 15 79715879 missense possibly damaging 0.64
R4431:Gtpbp1 UTSW 15 79716197 missense probably damaging 1.00
R4583:Gtpbp1 UTSW 15 79715951 missense possibly damaging 0.64
R4854:Gtpbp1 UTSW 15 79719205 missense probably benign
R4925:Gtpbp1 UTSW 15 79715968 missense probably benign 0.23
R5023:Gtpbp1 UTSW 15 79719221 missense possibly damaging 0.49
R5052:Gtpbp1 UTSW 15 79715969 missense probably damaging 1.00
R5695:Gtpbp1 UTSW 15 79712174 unclassified probably null
R6009:Gtpbp1 UTSW 15 79712096 missense probably damaging 1.00
R6089:Gtpbp1 UTSW 15 79706997 missense probably benign 0.15
R7088:Gtpbp1 UTSW 15 79719282 missense
R7343:Gtpbp1 UTSW 15 79691042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCAAGATGTTCCTCAACC -3'
(R):5'- GACTACGTGGTCCAGACTTAG -3'

Sequencing Primer
(F):5'- CCTGCTGAGTTCCAGATAGATGAC -3'
(R):5'- CCAGACTTAGTGGAGTTCAGG -3'
Posted On2019-09-13