Incidental Mutation 'R7383:Olfr124'
ID572908
Institutional Source Beutler Lab
Gene Symbol Olfr124
Ensembl Gene ENSMUSG00000044985
Gene Nameolfactory receptor 124
SynonymsA3, GA_x6K02T2PSCP-2264806-2265753, MOR256-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37799888-37808617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37806081 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 312 (K312R)
Ref Sequence ENSEMBL: ENSMUSP00000148904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053599] [ENSMUST00000215168] [ENSMUST00000216478] [ENSMUST00000217365]
Predicted Effect probably benign
Transcript: ENSMUST00000053599
AA Change: K312R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050544
Gene: ENSMUSG00000044985
AA Change: K312R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9e-6 PFAM
Pfam:7tm_1 41 290 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215168
AA Change: K312R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
AA Change: K312R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217365
AA Change: K312R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a significantly reduced density of olfactory sensory neurons in the septal organ, and show altered patterns of odorant responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Olfr124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Olfr124 APN 17 37806050 missense probably benign 0.00
IGL01512:Olfr124 APN 17 37805612 missense probably damaging 0.99
IGL01986:Olfr124 APN 17 37806066 missense probably damaging 1.00
IGL03151:Olfr124 APN 17 37805268 missense probably damaging 1.00
R0060:Olfr124 UTSW 17 37806000 missense probably damaging 0.99
R0060:Olfr124 UTSW 17 37806000 missense probably damaging 0.99
R1075:Olfr124 UTSW 17 37805769 nonsense probably null
R1177:Olfr124 UTSW 17 37805952 missense probably benign 0.36
R1422:Olfr124 UTSW 17 37805363 missense probably damaging 0.98
R1875:Olfr124 UTSW 17 37805105 start gained probably benign
R2088:Olfr124 UTSW 17 37805795 missense probably benign 0.22
R4712:Olfr124 UTSW 17 37805700 nonsense probably null
R6025:Olfr124 UTSW 17 37805421 missense probably damaging 1.00
R6241:Olfr124 UTSW 17 37805541 missense probably damaging 1.00
R6992:Olfr124 UTSW 17 37805863 missense probably damaging 1.00
R7221:Olfr124 UTSW 17 37805561 missense probably benign 0.04
R7659:Olfr124 UTSW 17 37805163 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCAGTATGTATGTTCAGCCTCC -3'
(R):5'- AGTGCTCAGTCTTGCTTCAG -3'

Sequencing Primer
(F):5'- CCTCAAGCTACTCTCATGAAAGGGG -3'
(R):5'- GCTCAAGCATCCCATAAGGTTATTGC -3'
Posted On2019-09-13